307 - 16189 Homo sapiens - Duplications Duplication length: 688 bp Duplicated region: 16189:307 Partially duplicated molecule length: 17257 bp Does not duplicate any origin of replication Duplicating part of major arc	Breakpoint flanking sequences more information in Documentation - Flanking regions
	307 5fl vs 3del Homology length: 8 bp Non-duplicated region 16189 AAAATTTCCACCAAACCCCC ├ 5'Breakpoint ┤ CCTCCCCCGCTTCTGGCCAC (...) CAATCCACATCAAAACCCCC ├ 3'Breakpoint ┤ TCCCCATGCTTACAAGCAAG 5del vs 3del Homology length: 2 bp AAAATTTCCACCAAACCCCC ├ 5'Breakpoint ┤ CCTCCCCCGCTTCTGGCCAC (...) CAATCCACATCAAAACCCCC ├ 3'Breakpoint ┤ TCCCCATGCTTACAAGCAAG

Two-dimensional scatterplot showing the location of the selected duplication (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.	Circular mtDNA plot specifying the location of the duplicated region (black bar).
Length distribution of the duplicated region in the selected duplication (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

References

 [31] Wei, Y-H., et al., Tandem duplications and large-scale deletions of mitochondrial DNA are early molecular events of human ageing process.Annals of New York Academy of Sciences. 1996. 786: p. 82-101.