9486 - 9502 Homo sapiens - Deletions Deletion length: 15 bp Does not remove any origin of replication Inside the major arc	Breakpoint flanking sequences more information in Documentation - Flanking regions
	9486 5fl vs 3del Homology length: 7 bp Deleted region 9502 TACCTCAGAAGTTTTTTTCT ├ 5'Breakpoint ┤ TCGCAGGATTTTTCTGAGCC (...) TTTCTTCGCAGGATTTTTCT ├ 3'Breakpoint ┤ GAGCCTTTTACCACTCCAGC 5del vs 3del Homology length: 15 bp TACCTCAGAAGTTTTTTTCT ├ 5'Breakpoint ┤ TCGCAGGATTTTTCTGAGCC (...) TTTCTTCGCAGGATTTTTCT ├ 3'Breakpoint ┤ GAGCCTTTTACCACTCCAGC

Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.	Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

Present in:
Osteosarcoma cell line
Recurrent myoglobinuria; Mitochondrial myopathy; COX deficiency

References

 [268] Hoffbuhr, K.C., et al., A pathogenic 15-base pair deletion in mitochondrial DNA-encoded cytochrome c oxidase subunit III results in the absence of functional cytochrome c oxidase. Journal of Biological Chemistry. 2000. 275(18): p. 13994-4003.

 [269] Keightley, J.A., et al., A microdeletion in cytochrome c oxidase (COX) subunit III associated with COX deficiency and recurrent myoglobinuria. Nature Genetics. 1996. 12(4): p. 410-6.

 [270] Taivassalo, T., et al., Venous oxygen levels during aerobic forearm exercise: An index of impaired oxidative metabolism in mitochondrial myopathy. Annals of Neurology. 2002. 51(1): p. 38-44.

 [271] Taivassalo, T., et al., Aerobic conditioning in patients with mitochondrial myopathies: physiological, biochemical, and genetic effects. Annals of Neurology. 2001. 50(2): p. 133-41.