9320 - 14273 Homo sapiens - Deletions Deletion length: 4952 bp Does not remove any origin of replication Inside the major arc	Breakpoint flanking sequences more information in Documentation - Flanking regions
	9320 5fl vs 3del Homology length: 1 bp Deleted region 14273 CCATGTGATTTCACTTCCAC ├ 5'Breakpoint ┤ TCCATAACGCTCCTCATACT (...) CAATAGGATCCTCCCGAATC ├ 3'Breakpoint ┤ AACCCTGACCCCTCTCCTTC 5del vs 3del Homology length: 2 bp CCATGTGATTTCACTTCCAC ├ 5'Breakpoint ┤ TCCATAACGCTCCTCATACT (...) CAATAGGATCCTCCCGAATC ├ 3'Breakpoint ┤ AACCCTGACCCCTCTCCTTC

Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.	Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

References

 [130] Granewald, T., et al., Chronic progressive external ophthalmoplegia with a novel mitochondrial DNA deletion and a mutation in the tRNA (Leu(UUR)) gene. Drug Development Research. 1999. 46(1): p. 80-85.