9287 - 12654 Mus Musculus - Deletions Deletion length: 3366 bp	Breakpoint flanking sequences more information in Documentation - Flanking regions
	9287 5fl vs 3del Homology length: 4 bp Deleted region 12654 GACAACTAAAATTTCACTTC ├ 5'Breakpoint ┤ ACATCAAAACATCACTTCGG (...) TCAAAAAAATCATTGCCTTC ├ 3'Breakpoint ┤ TCTACATCAAGCCAACTAGG 5fl vs 3fl Homology length: 2 bp GACAACTAAAATTTCACTTC ├ 5'Breakpoint ┤ ACATCAAAACATCACTTCGG (...) TCAAAAAAATCATTGCCTTC ├ 3'Breakpoint ┤ TCTACATCAAGCCAACTAGG

Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.	Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

References

 [14] Vermulst, M., et al., DNA deletions and clonal mutations drive premature aging in mitochondrial mutator mice.Nature Genetics. 2008. 40(4): p. 392-4.