Loading, please wait...

Loading, please wait.



9144 - 13816
Homo sapiens - Deletions

Deletion length: 4671 bp

Does not remove any origin of replication
Inside the major arc



Breakpoint flanking sequences
more information in Documentation - Flanking regions
9144 Deleted region 13816
CTATCCTAGAAATCGCTGTC 5'Breakpoint GCCTTAATCCAAGCCTACGT (...) AACTCACAGCCCTCGCTGTC 3'Breakpoint ACTTTCCTAGGACTTCTAAC




Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.

Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

References

 [118] Ota, Y., et al., Detection of platelet mitochondrial DNA deletions in Kearns-Sayre syndrome. Investigative Ophthalmology and Visual Science. 1991. 32(10): p. 2667-75.

 [265] Rocher, C., et al., Base composition at mtDNA boundaries suggests a DNA triple helix model for human mitochondrial DNA large-scale rearrangements. Molecular Genetics and Metabolism. 2002. 76(2): p. 123-32.