9103 - 12977 Mus Musculus - Deletions Deletion length: 3873 bp

Breakpoint flanking sequences more information in Documentation - Flanking regions

9103 5fl vs 3del Homology length: 15 bp Deleted region 12977 AATCAAGCCCTACTAATTAC ├ 5'Breakpoint ┤ CATTATACTAGGACTTTACT (...) GCCTGAGCCCTACTAATTAC ├ 3'Breakpoint ┤ ACTAATCGCCACTTCTATAA 5fl vs 3fl Homology length: 2 bp AATCAAGCCCTACTAATTAC ├ 5'Breakpoint ┤ CATTATACTAGGACTTTACT (...) GCCTGAGCCCTACTAATTAC ├ 3'Breakpoint ┤ ACTAATCGCCACTTCTATAA 5del vs 3del Homology length: 1 bp AATCAAGCCCTACTAATTAC ├ 5'Breakpoint ┤ CATTATACTAGGACTTTACT (...) GCCTGAGCCCTACTAATTAC ├ 3'Breakpoint ┤ ACTAATCGCCACTTCTATAA

Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.	Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

References

 [2] Tanhauser, S. M., Laipis, P. J., Multiple deletions are detectable in mitochondrial DNA of aging mice.The Journal of Biological Chemistry. 1995. 270(42): p. 24769-75.

 [4] Chung, S. S., et al., Analysis of age-associated mitochondrial DNA deletion breakpoint regions from mice suggests a novel model of deletion formation.Age. 1996. 19(4): p. 117-128.

 [5] Wang, E., et al., The rate of mitochondrial mutagenesis is faster in mice than humans.Mutation Research. 1997. 377(2): p. 157-66.

 [8] Fujibayashi, Y., et al., Increased mitochondrial DNA deletion in the brain of SAMP8, a mouse model for spontaneous oxidative stress barin.Neuroscience Letters. 1998. 254(2): p. 109-12.

 [14] Vermulst, M., et al., DNA deletions and clonal mutations drive premature aging in mitochondrial mutator mice.Nature Genetics. 2008. 40(4): p. 392-4.

 [18] Brossas, J. Y., et al., Multiple deletions in mitochondrial DNA are present in senescent mouse brain.Biochemical and Biophysical Research Communications. 1994. 202(2): p. 654-9.

 [21] Zeng, Z., et al., Mitochondrial DNA deletions are associated with ischemia and aging in Balb/c mouse brain.Journal of Cellular Biochemistry. 1999. 73(4): p. 545-53.

 [22] Zhang, W., et al., Mediating effect of ROS on mtDNA damage and low ATP content induced by arsenic trioxide in mouse oocytes.Toxicology in Vitro. 2011. 25(4): p. 979-84.

 [23] Kronenberg, G., et al., Folate deficiency increases mtDNA and D-1 mtDNa deletion in aged brain of mice lacking uracil-DNA glycosylase.Experimental Neurology. 2011. 228(2): p. 253-8.