8992 - 16072 Homo sapiens - Deletions Deletion length: 7079 bp Does not remove any origin of replication Inside the major arc	Breakpoint flanking sequences more information in Documentation - Flanking regions
	8992 5fl vs 3del Homology length: 1 bp Deleted region 16072 ACTCATTCAACCAATAGCCC ├ 5'Breakpoint ┤ TGGCCGTACGCCTAACCGCT (...) CCACCCAAGTATTGACTCAC ├ 3'Breakpoint ┤ CCATCAACAACCGCTATGTA 5fl vs 3fl Homology length: 2 bp ACTCATTCAACCAATAGCCC ├ 5'Breakpoint ┤ TGGCCGTACGCCTAACCGCT (...) CCACCCAAGTATTGACTCAC ├ 3'Breakpoint ┤ CCATCAACAACCGCTATGTA

Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.	Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

Present in:
Hepatic tumors
Cirrhotic liver; Cardiomyopathy; Dilated cardiomyopathy

References

 [144] Hattori, K., et al., Cardiomyopathy with mitochondrial DNA mutations. American Heart Journal. 1991. 122(3 Pt 1): p. 866-9.

 [145] Ito, T., et al., Mitochondrial DNA mutations in cardiomyopathy. Japanese Circulation Journal. 1992. 56(10): p. 1045-53.

 [146] Yamamoto, H., et al., Significant existence of deleted mitochondrial DNA in cirrhotic liver surrounding hepatic tumor. Biochemical and Biophysical Research Communications. 1992. 182(2): p. 913-20.