8838 - 14906 Homo sapiens - Deletions Deletion length: 6067 bp Does not remove any origin of replication Inside the major arc	Breakpoint flanking sequences more information in Documentation - Flanking regions
	8838 5fl vs 3del Homology length: 10 bp Deleted region 14906 TATCTATAAACCTAGCCATG ├ 5'Breakpoint ┤ GCCATCCCCTTATGAGCGGG (...) CAGGACTATTCCTAGCCATG ├ 3'Breakpoint ┤ CACTACTCACCAGACGCCTC 5del vs 3del Homology length: 1 bp TATCTATAAACCTAGCCATG ├ 5'Breakpoint ┤ GCCATCCCCTTATGAGCGGG (...) CAGGACTATTCCTAGCCATG ├ 3'Breakpoint ┤ CACTACTCACCAGACGCCTC

Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.	Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

Present in:
KSS
Mitochondrial myopathy; Multisystemic mitochondrial disorders

References

 [136] Larsson, N.G. and E. Holme, Multiple short direct repeats associated with single mtDNA deletions. Biochimica Et Biophysica Acta. 1992. 1139(4): p. 311-4.

 [137] Larsson, N.G., et al., Progressive increase of the mutated mitochondrial DNA fraction in Kearns-Sayre syndrome. Pediatric Research. 1990. 28(2): p. 131-6.

 [265] Rocher, C., et al., Base composition at mtDNA boundaries suggests a DNA triple helix model for human mitochondrial DNA large-scale rearrangements. Molecular Genetics and Metabolism. 2002. 76(2): p. 123-32.