Loading, please wait...

Loading, please wait.



8823 - 15855
Homo sapiens - Deletions

Deletion length: 7031 bp

Does not remove any origin of replication
Inside the major arc



Breakpoint flanking sequences
more information in Documentation - Flanking regions
8823 Deleted region 15855
CACCAACCACCCAACTATCT 5'Breakpoint ATAAACCTAGCCATGGCCAT (...) AATCCTAATACCAACTATCT 3'Breakpoint CCCTAATTGAAAACAAAATA




Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.

Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

References

 [11] Degoul, F., et al., Different Mechanisms Inferred from Sequences of Human Mitochondrial-DNA Deletions in Ocular Myopathies. Nucleic Acids Research. 1991. 19(3): p. 493-496.

 [265] Rocher, C., et al., Base composition at mtDNA boundaries suggests a DNA triple helix model for human mitochondrial DNA large-scale rearrangements. Molecular Genetics and Metabolism. 2002. 76(2): p. 123-32.