8648 - 16085 Homo sapiens - Deletions Deletion length: 7436 bp Does not remove any origin of replication Inside the major arc	Breakpoint flanking sequences more information in Documentation - Flanking regions
	8648 Deleted region 16085 AAATATCTCATCAACAACCG ├ 5'Breakpoint ┤ ACTAATCACCACCCAACAAT (...) GACTCACCCATCAACAACCG ├ 3'Breakpoint ┤ CTATGTATTTCGTACATTAC

Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.	Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

Present in:
PS; KSS
Mitochondrial myopathy; Patients with pathogenic MGME1 mutations
Sublimons; Aged tissues; Unfertilized oocytes
Inclusion body myositis
Hepatic tumors
Cirrhotic liver; Diabetes mellitus and adrenal insufficiency; Chronic fatigue syndrome; Cardiomyopathy; Multiorgan involvement (Sporadic); Adrenal insuffiency and deafness; Diabetes mellitus and adrenal insufficiency; Multisystemic mitochondrial disorders; Hippocampal tissue of patients with mesial temporal lobe epilepsy (mTLE) and hippocampal sclerosis (HS)

References

 [18] Ferlin, T., et al., Detection of mitochondrial DNA deletions by a screening procedure using the polymerase chain reaction. Molecular and Cellular Biochemistry. 1997. 174(1-2): p. 221-225.

 [21] Hsieh, R.H., et al., Multiple rearrangements of mitochondrial DNA in unfertilized human oocytes. Fertility and Sterility. 2002. 77(5): p. 1012-7.

 [22] Jansson, M., et al., Multiple mitochondrial DNA deletions in hereditary inclusion body myopathy. Acta Neuropathologica. 2000. 100(1): p. 23-8.

 [23] Kajander, O.A., et al., Human mtDNA sublimons resemble rearranged mitochondrial genoms found in pathological states. Human Molecular Genetics. 2000. 9(19): p. 2821-35.

 [24] Moslemi, A.R., C. Lindberg, and A. Oldfors, Analysis of multiple mitochondrial DNA deletions in inclusion body myositis. Human Mutation. 1997. 10(5): p. 381-6.

 [29] Kleinle, S., et al., Detection and characterization of mitochondrial DNA rearrangements in Pearson and Kearns-Sayre syndromes by long PCR. Human Genetics. 1997. 100(5-6): p. 643-50.

 [107] Rotig, A., et al., Spectrum of mitochondrial DNA rearrangements in the Pearson marrow-pancreas syndrome. Human Molecular Genetics. 1995. 4(8): p. 1327-30.

 [144] Hattori, K., et al., Cardiomyopathy with mitochondrial DNA mutations. American Heart Journal. 1991. 122(3 Pt 1): p. 866-9.

 [146] Yamamoto, H., et al., Significant existence of deleted mitochondrial DNA in cirrhotic liver surrounding hepatic tumor. Biochemical and Biophysical Research Communications. 1992. 182(2): p. 913-20.

 [153] Chabi, B., et al., Quantification of mitochondrial DNA deletion, depletion, and overreplication: application to diagnosis. Clinical Chemistry. 2003. 49(8): p. 1309-17.

 [162] Zhang, C., et al., Unusual pattern of mitochondrial DNA deletions in skeletal muscle of an adult human with chronic fatigue syndrome. Human Molecular Genetics. 1995. 4(4): p. 751-4.

 [163] Zhang, C., et al., Multiple Mitochondrial-DNA Deletions in an Elderly Human Individual. FEBS Letters. 1992. 297(1-2): p. 34-38.

 [164] Hattori, K., et al., Age-dependent increase in deleted mitochondrial DNA in the human heart: possible contributory factor to presbycardia. American Heart Journal. 1991. 121(6 Pt 1): p. 1735-42.

 [165] Hayakawa, M., et al., Age-associated oxygen damage and mutations in mitochondrial DNA in human hearts. Biochemical and Biophysical Research Communications. 1992. 189(2): p. 979-85.

 [166] Nicolino, M., et al., Identification of a large-scale mitochondrial deoxyribonucleic acid deletion in endocrinopathies and deafness: report of two unrelated cases with diabetes mellitus and adrenal insufficiency, respectively. The Journal of Clinical Endocrinology and Metabolism. 1997. 82(9): p. 3063-7.

 [167] Zeviani, M., et al., An Autosomal Dominant Disorder with Multiple Deletions of Mitochondrial-DNA Starting at the D-Loop Region. Nature. 1989. 339(6222): p. 309-311.

 [265] Rocher, C., et al., Base composition at mtDNA boundaries suggests a DNA triple helix model for human mitochondrial DNA large-scale rearrangements. Molecular Genetics and Metabolism. 2002. 76(2): p. 123-32.

 [322] Sadikovic, B., et al., Sequence homology at the breakpoint and clinical phenotype of mitochondrial DNA deletion syndromes. Plos one. 2010. 5(12): p. e15687.

 [327] Nicholls, Thomas J., et al., Linear mtDNA fragments and unusual mtDNA rearrangements associated with pathological deficiency of MGME1 exonuclease. Human Molecular Genetics. 2014. 23: p. 6147-6162.

 [330] Volmering, E., et al., Neuropathological signs of inflammation correlate with mitochondrial DNA deletions in mesial temporal lobe epilepsy. Acta Neuropathologica. 2016. 132(2): p. 277-288.

 [355] Pang, G., Wey, S., et al., Kearns–Sayre Syndrome Minus: Two Cases of Identical Large‐Scale Mitochondrial DNA Deletions with Presentations outside the Classical Triad..Case Reports in Genetics. 2022. 2022(1): p.4153357.