Loading, please wait...

Loading, please wait.



8482 - 13460
Homo sapiens - Deletions

Deletion length: 4977 bp

Does not remove any origin of replication
Inside the major arc



Breakpoint flanking sequences
more information in Documentation - Flanking regions


8482
5fl vs 3del
Homology length: 13 bp

Deleted region


13460
ACCACCTACCTCCCTCACCA 5'Breakpoint AAGCCCATAAAAATAAAAAA (...) CACTTCAACCTCCCTCACCA 3'Breakpoint TTGGCAGCCTAGCATTAGCA
5del vs 3del
Homology length: 1 bp

ACCACCTACCTCCCTCACCA 5'Breakpoint AAGCCCATAAAAATAAAAAA (...) CACTTCAACCTCCCTCACCA 3'Breakpoint TTGGCAGCCTAGCATTAGCA




Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.

Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.
Present in:
KSS; PEO; PS
ad/ar-PEO; ad/ar-PEO (POLGmut)
Aged tissues; Unfertilized oocytes; Spermatozoa; Postmenopausal ovaries; Embryos; Cumullus cells; Controls
Parkinson Disease
Inclusion body myopathy (ad); Inclusion body myositis
Thyroid, Hepatic, Warthin's, Goiters tumors; Sporadic breast cancer and benign breast diseases
Reye-like; Alzheimer Disease; Huntington's Disease; Adrenal failure; Hemodialysis patients; Cyclic vomiting syndrome; Hearts exposed to doxorubicin; Pancytopenia; Microvesicular stetosis; Presbiacusis; Cerebral folate deficiency; Atrial fibrillation; Ataxia telangiectasia; Sporadic Amyotrophic Lateral Sclerosis; Toni-Debré-Fanconi syndrome; Chronic Kidney Disease; Polypodium treated patients; Ptosis, ophthalmoparesis; facial paresis; ophthalmoplesia; retinopathy; ataxia cerebellum syndrome; myopathy; tetraparesis; Skeletal Muscle Symptoms; multiorgan involvement; multiple deletion patient; Dilated cardiomyopathy; Chronic Fatigue Syndrome; Sensorineural Hearing Loss; MELAS; MERRF; Diabetes mellitus and deafness; Mitochondrial encephalomyopathy; Mitochondrial myopathy; COX deficiency; LS; Isolated mitochondrial myopathy; Sun-exposed skin; Skeletal muscle biopsies and fibroblasts of CMT2A patients; Hippocampal tissue of patients with mesial temporal lobe epilepsy (mTLE) and hippocampal sclerosis (HS)

References

 [2] Goios, A., et al., mtDNA single macrodeletions associated with myopathies: absence of haplogroup-related increased risk. Journal of Inherited Metabolic Disease. 2005. 28(5): p. 769-78.

 [6] Bodyak, N.D., et al., Quantification and sequencing of somatic deleted mtDNA in single cells: evidence for partially duplicated mtDNA in aged human tissues. Human Molecular Genetics. 2001. 10(1): p. 17-24.

 [11] Degoul, F., et al., Different Mechanisms Inferred from Sequences of Human Mitochondrial-DNA Deletions in Ocular Myopathies. Nucleic Acids Research. 1991. 19(3): p. 493-496.

 [18] Ferlin, T., et al., Detection of mitochondrial DNA deletions by a screening procedure using the polymerase chain reaction. Molecular and Cellular Biochemistry. 1997. 174(1-2): p. 221-225.

 [21] Hsieh, R.H., et al., Multiple rearrangements of mitochondrial DNA in unfertilized human oocytes. Fertility and Sterility. 2002. 77(5): p. 1012-7.

 [22] Jansson, M., et al., Multiple mitochondrial DNA deletions in hereditary inclusion body myopathy. Acta Neuropathologica. 2000. 100(1): p. 23-8.

 [24] Moslemi, A.R., C. Lindberg, and A. Oldfors, Analysis of multiple mitochondrial DNA deletions in inclusion body myositis. Human Mutation. 1997. 10(5): p. 381-6.

 [25] Samuels, D.C., E.A. Schon, and P.F. Chinnery, Two direct repeats cause most human mtDNA deletions. Trends in Genetics. 2004. 20(9): p. 393-8.

 [27] Kao, S.H., H.T. Chao, and Y.H. Wei, Multiple deletions of mitochondrial DNA are associated with the decline of motility and fertility of human spermatozoa. Molecular Human Reproduction. 1998. 4(7): p. 657-66.

 [32] Kraytsberg, Y., et al., Mitochondrial DNA deletions are abundant and cause functional impairment in aged human substantia nigra neurons. Nature Genetics. 2006. 38(5): p. 518-20.

 [33] Reeve, A.K., et al., Nature of mitochondrial DNA deletions in substantia nigra neurons. American Journal of Human Genetics. 2008. 82(1): p. 228-35.

 [40] Mita, S., et al., Recombination Via Flanking Direct Repeats Is a Major Cause of Large-Scale Deletions of Human Mitochondrial-DNA. Nucleic Acids Research. 1990. 18(3): p. 561-567.

 [41] Moraes, C.T., et al., Molecular analysis of the muscle pathology associated with mitochondrial DNA deletions. Nature Genetics. 1992. 1(5): p. 359-67.

 [42] Nakase, H., et al., Transcription and Translation of Deleted Mitochondrial Genomes in Kearns-Sayre Syndrome - Implications for Pathogenesis. American Journal of Human Genetics. 1990. 46(3): p. 418-427.

 [44-47] Tengan, C.H., et al., Frequency of duplications in the D-loop in patients with mitochondrial DNA deletions. Biochimica Et Biophysica Acta. 2002. 1588(1): p. 65-70.

 [49] Maximo, V., et al., Mitochondrial DNA somatic mutations (point mutations and large deletions) and mitochondrial DNA variants in human thyroid pathology: a study with emphasis on Hurthle cell tumors. American Journal of Pathology. 2002. 160(5): p. 1857-65.

 [76] Ito, M., et al., Screening for mitochondrial DNA heteroplasmy in children at risk for mitochondrial disease. Mitochondrion. 2001. 1(3): p. 269-78.

 [107] Rotig, A., et al., Spectrum of mitochondrial DNA rearrangements in the Pearson marrow-pancreas syndrome. Human Molecular Genetics. 1995. 4(8): p. 1327-30.

 [110] Tanaka, M., et al., Direct sequencing of deleted mitochondrial DNA in myopathic patients. Biochemical and Biophysical Research Communications. 1989. 164(1): p. 156-63.

 [116] Rotig, A., et al., Site-specific deletions of the mitochondrial genome in the Pearson marrow-pancreas syndrome. Genomics. 1991. 10(2): p. 502-4.

 [119] Johns, D.R., et al., Directly repeated sequences associated with pathogenic mitochondrial DNA deletions. Proceedings of the National Academy of Sciences of the United States of America. 1989. 86(20): p. 8059-62.

 [120] Hsieh, R.H., et al., Age-dependent respiratory function decline and DNA deletions in human muscle mitochondria. Biochemistry and Molecular Biology International. 1994. 32(6): p. 1009-22.

 [121] Yen, T.C., et al., Age-dependent increase of mitochondrial DNA deletions together with lipid peroxides and superoxide dismutase in human liver mitochondria. Free Radical Biology and Medicine. 1994. 16(2): p. 207-14.

 [125] Rotig, A., et al., Pearson's marrow-pancreas syndrome. A multisystem mitochondrial disorder in infancy. Journal of Clinical Investigation. 1990. 86(5): p. 1601-8.

 [127] Boles, R.G., E.E. Baldwin, and T.R. Prezant, Combined cyclic vomiting and Kearns-Sayre syndromes. Pediatric Neurology. 2007. 36(2): p. 135-6.

 [138] Moraes, C.T., et al., Phenotype-genotype correlations in skeletal muscle of patients with mtDNA deletions. Muscle & Nerve. 1995. 3: p. S150-3.

 [147] Remes, A.M., et al., Mitochondrial DNA deletions in dilated cardiomyopathy: a clinical study employing endomyocardial sampling. Journal of the American College of Cardiology. 1994. 23(4): p. 935-42.

 [148] Markaryan, A., E.G. Nelson, and R. Hinojosa, Detection of mitochondrial DNA deletions in the cochlea and its structural elements from archival human temporal bone tissue. Mutation Research. 2008. 640(1-2): p. 38-45.

 [153] Chabi, B., et al., Quantification of mitochondrial DNA deletion, depletion, and overreplication: application to diagnosis. Clinical Chemistry. 2003. 49(8): p. 1309-17.

 [154] Degoul, F., et al., Deletions of mitochondrial DNA in Kearns-Sayre syndrome and ocular myopathies: genetic, biochemical and morphological studies. Journal of the Neurological Sciences. 1991. 101(2): p. 168-77.

 [159] Lebrecht, D., et al., Tissue-specific mtDNA lesions and radical-associated mitochondrial dysfunction in human hearts exposed to doxorubicin. The Journal of Pathology. 2005. 207(4): p. 436-44.

 [162] Zhang, C., et al., Unusual pattern of mitochondrial DNA deletions in skeletal muscle of an adult human with chronic fatigue syndrome. Human Molecular Genetics. 1995. 4(4): p. 751-4.

 [163] Zhang, C., et al., Multiple Mitochondrial-DNA Deletions in an Elderly Human Individual. FEBS Letters. 1992. 297(1-2): p. 34-38.

 [168] Carrozzo, R., et al., Multiple mtDNA deletions features in autosomal dominant and recessive diseases suggest distinct pathogeneses. Neurology. 1998. 50(1): p. 99-106.

 [174] Vu, T.H., et al., Analysis of mtDNA deletions in muscle by in situ hybridization. Muscle & Nerve. 2000. 23(1): p. 80-5.

 [175] Pang, C.Y., et al., Human skin mitochondrial DNA deletions associated with light exposure. Archives of Biochemistry and Biophysics. 1994. 312(2): p. 534-8.

 [176] Moslemi, A.R., et al., Clonal expansion of mitochondrial DNA with multiple deletions in autosomal dominant progressive external ophthalmoplegia. Annals of Neurology. 1996. 40(5): p. 707-713.

 [177] Mohri, I., et al., A case of Kearns-Sayre syndrome showing a constant proportion of deleted mitochondrial DNA in blood cells during 6 years of follow-up. Journal of the Neurological Sciences. 1998. 158(1): p. 106-9.

 [178] Shoffner, J.M., et al., Spontaneous Kearns-Sayre Chronic External Ophthalmoplegia Plus Syndrome Associated with a Mitochondrial-DNA Deletion - a Slip Replication Model and Metabolic Therapy. Proceedings of the National Academy of Sciences of the United States of America. 1989. 86(20): p. 7952-7956.

 [179] Bernes, S.M., et al., Identical mitochondrial DNA deletion in mother with progressive external ophthalmoplegia and son with Pearson marrow-pancreas syndrome. Journal of Pediatrics. 1993. 123(4): p. 598-602.

 [180] Blanchard, B.J., et al., A mitochondrial DNA deletion in normally aging and in Alzheimer brain tissue. NeuroReport. 1993. 4(6): p. 799-802.

 [181] Bourgeron, T., et al., Fate and expression of the deleted mitochondrial DNA differ between human heteroplasmic skin fibroblast and Epstein-Barr virus-transformed lymphocyte cultures. Journal of Biological Chemistry. 1993. 268(26): p. 19369-76.

 [182] Brockington, M., et al., A tandem duplication in the D-loop of human mitochondrial DNA is associated with deletions in mitochondrial myopathies. Nature Genetics. 1993. 4(1): p. 67-71.

 [183] Corral-Debrinski, M., et al., Mitochondrial-DNA Deletions in Human Brain - Regional Variability and Increase with Advanced Age. Nature Genetics. 1992. 2(4): p. 324-329.

 [184] Corral-Debrinski, M., et al., Marked changes in mitochondrial DNA deletion levels in Alzheimer brains. Genomics. 1994. 23(2): p. 471-6.

 [185] Corral-Debrinski, M., et al., Association of mitochondrial DNA damage with aging and coronary atherosclerotic heart disease. Mutation Research. 1992. 275(3-6): p. 169-80.

 [186] Cortopassi, G.A. and N. Arnheim, Detection of a specific mitochondrial DNA deletion in tissues of older humans. Nucleic Acids Research. 1990. 18(23): p. 6927-33.

 [187] DiDonato, S., et al., Respiratory chain and mitochondrial DNA in muscle and brain in Parkinson's disease patients. Neurology. 1993. 43(11): p. 2262-8.

 [188] Ernst, B.P., et al., Deletion screening of mitochondrial DNA via multiprimer DNA amplification. Molecular and Cellular Probes. 1994. 8(1): p. 45-9.

 [189] Goto, Y., et al., Chronic progressive external ophthalmoplegia: a correlative study of mitochondrial DNA deletions and their phenotypic expression in muscle biopsies. Journal of the Neurological Sciences. 1990. 100(1-2): p. 63-9.

 [190] Gurgey, A., et al., Pearson's marrow-pancreas syndrome in 2 Turkish children. Acta Haematologica. 1992. 87(4): p. 206-9.

 [191] Holt, I.J., et al., Mitochondrial myopathies: clinical and biochemical features of 30 patients with major deletions of muscle mitochondrial DNA. Annals of Neurology. 1989. 26(6): p. 699-708.

 [192] Holt, I.J., A.E. Harding, and J.A. Morgan-Hughes,. Deletions of muscle mitochondrial DNA in patients with mitochondrial myopathies. Nature. 1988. 331(6158): p. 717-9

 [193] Holt, I.J., A.E. Harding, and J.A. Morgan-Hughes, Deletions of muscle mitochondrial DNA in mitochondrial myopathies: sequence analysis and possible mechanisms. Nucleic Acids Research. 1989. 17(12): p. 4465-9.

 [194] Ikebe, S., et al., Increase of deleted mitochondrial DNA in the striatum in Parkinson's disease and senescence. Biochemical and Biophysical Research Communications. 1990. 170(3): p. 1044-8.

 [195] Johns, D.R., mtDNA deletions in Kearns-Sayre. Neurology. 1990. 40(8): p. 1322-3.

 [196] Lee, H.C., et al., Differential accumulations of 4,977 bp deletion in mitochondrial DNA of various tissues in human ageing. Biochimica Et Biophysica Acta. 1994. 1226(1): p. 37-43.

 [197] Lestienne, P. and G. Ponsot, Kearns-Sayre syndrome with muscle mitochondrial DNA deletion. Lancet. 1988. 1(8590): p. 885.

 [198] Linnane, A.W., et al., Mitochondrial gene mutation: the ageing process and degenerative diseases. Biochemistry International. 1990. 22(6): p. 1067-76.

 [199] Mann, V.M., J.M. Cooper, and A.H. Schapira, Quantitation of a mitochondrial DNA deletion in Parkinson's disease. FEBS Letters. 1992. 299(3): p. 218-22.

 [200] McShane, M.A., et al., Pearson syndrome and mitochondrial encephalomyopathy in a patient with a deletion of mtDNA. American Journal of Human Genetics. 1991. 48(1): p. 39-42.

 [201] Mita, S., et al., Detection of "deleted" mitochondrial genomes in cytochrome-c oxidase-deficient muscle fibers of a patient with Kearns-Sayre syndrome. Proceedings of the National Academy of Sciences of the United States of America. 1989. 86(23): p. 9509-13.

 [202] Moraes, C.T., et al., Mitochondrial DNA deletions in progressive external ophthalmoplegia and Kearns-Sayre syndrome. The New England Journal of Medicine. 1989. 320(20): p. 1293-9.

 [203] Muller-Hocker, J., et al., Different in situ hybridization patterns of mitochondrial DNA in cytochrome c oxidase-deficient extraocular muscle fibres in the elderly. Virchows Archive A, Pathological Anatomy and Histopathology. 1993. 422(1): p. 7-15.

 [204] Niaudet, P., et al., Deletion of the mitochondrial DNA in a case of de Toni-Debre-Fanconi syndrome and Pearson syndrome. Pediatric Nephrology. 1994. 8(2): p. 164-8.

 [205] Obermaier-Kusser, B., et al., Different copy numbers of apparently identically deleted mitochondrial DNA in tissues from a patient with Kearns-Sayre syndrome detected by PCR. Biochemical and Biophysical Research Communications. 1990. 169(3): p. 1007-15.

 [206] Ozawa, T., et al., Quantitative determination of deleted mitochondrial DNA relative to normal DNA in parkinsonian striatum by a kinetic PCR analysis. Biochemical and Biophysical Research Communications. 1990. 172(2): p. 483-9.

 [207] Poulton, J., et al., Germ-line deletions of mtDNA in mitochondrial myopathy. American Journal of Human Genetics. 1991. 48(4): p. 649-53.

 [208] Rotig, A., et al., Deletion of blood mitochondrial DNA in pancytopenia. Lancet. 1988. 2(8610): p. 567-8.

 [209] Rotig, A., et al., Mitochondrial DNA deletion in Pearson's marrow/pancreas syndrome. Lancet. 1989. 1(8643): p. 902-3.

 [210] Anan, R., et al., Cardiac involvement in mitochondrial diseases. A study on 17 patients with documented mitochondrial DNA defects. Circulation. 1995. 91(4): p. 955-61.

 [211] Bai, U., et al., Mitochondrial DNA deletions associated with aging and possibly presbycusis: a human archival temporal bone study. American Journal of Otolaryngology. 1997. 18(4): p. 449-53.

 [212] Chen, X., et al., Paucity of deleted mitochondrial DNAs in brain regions of Huntington's disease patients. Biochimica Et Biophysica Acta. 1995. 1271(1): p. 229-33.

 [213] Chen, X., et al., Rearranged mitochondrial genomes are present in human oocytes. American Journal of Human Genetics. 1995. 57(2): p. 239-47.

 [214] Fassati, A., et al., Chronic progressive external ophthalmoplegia: a correlative study of quantitative molecular data and histochemical and biochemical profile. Journal of the Neurological Sciences. 1994. 123(1-2): p. 140-6.

 [215] Fromenty, B., et al., Hepatic mitochondrial DNA deletion in alcoholics: association with microvesicular steatosis. Gastroenterology. 1995. 108(1): p. 193-200.

 [216] Fukushima, S., et al., The frequency of 4977 base pair deletion of mitochondrial DNA in various types of liver disease and in normal liver. Hepatology. 1995. 21(6): p. 1547-51.

 [217] Kao, S., H.T. Chao, and Y.H. Wei, Mitochondrial deoxyribonucleic acid 4977-bp deletion is associated with diminished fertility and motility of human sperm. Biology of Reproduction. 1995. 52(4): p. 729-36.

 [218] Keefe, D.L., et al., Mitochondrial deoxyribonucleic acid deletions in oocytes and reproductive aging in women. Fertility and Sterility. 1995. 64(3): p. 577-83.

 [219] Kitagawa, T., et al., Rapid accumulation of deleted mitochondrial deoxyribonucleic acid in postmenopausal ovaries. Biology of Reproduction. 1993. 49(4): p. 730-6.

 [220] Lee, H.C., et al., Ageing-associated tandem duplications in the D-loop of mitochondrial DNA of human muscle. FEBS Letters. 1994. 354(1): p. 79-83.

 [221] Lezza, A.M., et al., Correlation between mitochondrial DNA 4977-bp deletion and respiratory chain enzyme activities in aging human skeletal muscles. Biochemical and Biophysical Research Communications. 1994. 205(1): p. 772-9.

 [222] Muller-Hocker, J., U. Jacob, and P. Seibel, The common 4977 base pair deletion of mitochondrial DNA preferentially accumulates in the cardiac conduction system of patients with Kearns-Sayre syndrome. Modern Pathology. 1998. 11(3): p. 295-301.

 [223] Sano, T., et al., Molecular and genetic analyses of two patients with Pearson's marrow-pancreas syndrome. Pediatric Research. 1993. 34(1): p. 105-10.

 [224] Schon, E.A., et al., A direct repeat is a hotspot for large-scale deletion of human mitochondrial DNA. Science. 1989. 244(4902): p. 346-9.

 [225] Sciacco, M., et al., Distribution of wild-type and common deletion forms of mtDNA in normal and respiration-deficient muscle fibers from patients with mitochondrial myopathy. Human Molecular Genetics. 1994. 3(1): p. 13-9.

 [226] Shanske, S., et al., Widespread tissue distribution of mitochondrial DNA deletions in Kearns-Sayre syndrome. Neurology. 1990. 40(1): p. 24-8.

 [227] Simonetti, S., et al., Accumulation of deletions in human mitochondrial DNA during normal aging: analysis by quantitative PCR. Biochimica Et Biophysica Acta. 1992. 1180(2): p. 113-22.

 [228] Simonsz, H.J., K. Barlocher, and A. Rotig, Kearns-Sayre's syndrome developing in a boy who survived pearson's syndrome caused by mitochondrial DNA deletion. Documenta Ophthalmologica. 1992. 82(1-2): p. 73-9.

 [229] Soong, N.W., et al., Mosaicism for a specific somatic mitochondrial DNA mutation in adult human brain. Nature Genetics. 1992. 2(4): p. 318-23.

 [230] Suganuma, N., et al., Human ovarian aging and mitochondrial DNA deletion. Hormone Research. 1993. 39 Suppl 1: p. 16-21.

 [231] Ueda, N., et al., Mitochondrial DNA deletion is a predisposing cause for sensorineural hearing loss. Laryngoscope. 1998. 108(4 Pt 1): p. 580-4.

 [232] Wang, H., et al., Quantification of mitochondrial DNA in heteroplasmic fibroblasts with competitive PCR. Biotechniques. 1994. 17(1): p. 76-8, 80, 82

 [233] Yang, J.H., et al., A specific 4977-bp deletion of mitochondrial DNA in human ageing skin. Archives of Dermatological Research. 1994. 286(7): p. 386-90.

 [234] Zeviani, M., et al., Deletions of mitochondrial DNA in Kearns-Sayre syndrome. Neurology. 1988. 38(9): p. 1339-46.

 [235] Brenner, C.A., et al., Mitochondrial DNA deletion in human oocytes and embryos. Molecular Human Reproduction. 1998. 4(9): p. 887-92.

 [236] Lewis, P.D., et al., Detection of damage to the mitochondrial genome in the oncocytic cells of Warthin's tumour. The Journal of Pathology. 2000. 191(3): p. 274-81.

 [237] Maximo, V., et al., The common deletion of mitochondrial DNA is found in goiters and thyroid tumors with and without oxyphil cell change. Ultrastructural Pathology. 1998. 22(3): p. 271-3.

 [238] Meissner, C. and N. von Wurmb, Sensitive detection of the 4977-bp deletion in human mitochondrial DNA of young individuals. Biotechniques. 1998. 25(4): p. 652-4.

 [239] Porteous, W.K., et al., Bioenergetic consequences of accumulating the common 4977-bp mitochondrial DNA deletion. European Journal of Biochemistry. 1998. 257(1): p. 192-201.

 [240] Barritt, J.A., et al., Spontaneous and artificial changes in human ooplasmic mitochondria. Human Reproduction. 2000. 15 Suppl 2: p. 207-17.

 [241] Dai, P., et al., Correlation of cochlear blood supply with mitochondrial DNA common deletion in presbyacusis. Acta Oto-laryngologica. 2004. 124(2): p. 130-6.

 [242] Garcia-Cazorla, A., et al., Mitochondrial diseases associated with cerebral folate deficiency. Neurology. 2008. 70(16): p. 1360-2.

 [243] Lai, L.P., et al., Atrial fibrillation is associated with accumulation of aging-related common type mitochondrial DNA deletion mutation in human atrial tissue. Chest. 2003. 123(2): p. 539-44.

 [244] Lewis, P.D., et al., Authors' reply. Mitochondrial DNA damage and oncocytic neoplasia. The Journal of Pathology. 2000. 192(4): p. 562-3.

 [245] Prithivirajsingh, S., et al., Accumulation of the common mitochondrial DNA deletion induced by ionizing radiation. FEBS Letters. 2004. 571(1-3): p. 227-32.

 [246] Ro, L.S., et al., Deleted 4977-bp mitochondrial DNA mutation is associated with sporadic amyotrophic lateral sclerosis: a hospital-based case-control study. Muscle & Nerve. 2003. 28(6): p. 737-43.

 [247] Thayer, R.E., et al., A maternal line study investigating the 4977-bp mitochondrial DNA deletion. Experimental Gerontology. 2003. 38(5): p. 567-71.

 [248] Zhang, B., et al., A study of mitochondrial DNA mutations in peripheral lymphocytes in an aging cohort. Biochemical Society Transactions. 2003. 31(2): p. 444-6.

 [249] Berneburg, M., et al., Induction of the photoaging-associated mitochondrial common deletion in vivo in normal human skin. Journal of Investigative Dermatology. 2004. 122(5): p. 1277-83.

 [250] Chan, C.C., et al., Mitochondrial DNA content and 4977 bp deletion in unfertilized oocytes. Molecular Human Reproduction. 2005. 11(12): p. 843-6.

 [251] Dani, S.U., M.A. Dani, and A.J. Simpson, The common mitochondrial DNA deletion deltamtDNA(4977): shedding new light to the concept of a tumor suppressor mutation. Medical Hypotheses. 2003. 61(1): p. 60-3.

 [252] Houshmand, M., et al., Investigation on mtDNA deletions and twinkle gene mutation (G1423C) in Iranian patients with chronic progressive external opthalmoplagia. Neurology India. 2006. 54(2): p. 182-5.

 [253] Mawrin, C., et al., Single-cell analysis of mtDNA deletion levels in sporadic amyotrophic lateral sclerosis. NeuroReport. 2004. 15(6): p. 939-43.

 [254] Pallotti, F., et al., Evidence that specific mtDNA point mutations may not accumulate in skeletal muscle during normal human aging. American Journal of Human Genetics. 1996. 59(3): p. 591-602.

 [255] Pogozelski, W.K., et al., Quantification of total mitochondrial DNA and the 4977-bp common deletion in Pearson's syndrome lymphoblasts using a fluorogenic 5'-nuclease (TaqMan) real-time polymerase chain reaction assay and plasmid external calibration standards. Mitochondrion. 2003. 2(6): p. 415-27.

 [256] Yen, T.C., et al., Ageing-associated 5 kb deletion in human liver mitochondrial DNA. Biochemical and Biophysical Research Communications. 1991. 178(1): p. 124-31.

 [257] Bai, U. and M.D. Seidman, A specific mitochondrial DNA deletion (mtDNA4977) is identified in a pedigree of a family with hearing loss. Hearing Research. 2001. 154(1-2): p. 73-80.

 [258] Levin, B.C., et al., The common deletion found in patient reexamined after 33 years and comparison with complete mtDNA sequences of maternal relatives. Mitochondrion. 2005. 5(6): p. 403-10.

 [259] Mkaouar-Rebai, E., et al., A case of Kearns-Sayre syndrome with two novel deletions (9.768 and 7.253 kb) of the mtDNA associated with the common deletion in blood leukocytes, buccal mucosa and hair follicles. Mitochondrion. 2010. 10(5): p. 449-55.

 [260] Rao, M., et al., Mitochondrial DNA injury and mortality in hemodialysis patients. Journal of the American Society of Nephrology. 2009. 20(1): p. 189-96.

 [261] Rossato, L.B., et al., Prevalence of 4977bp deletion in mitochondrial DNA from patients with chronic kidney disease receiving conservative treatment or hemodialysis in southern Brazil. Renal Failure. 2008. 30(1): p. 9-14.

 [262] Tsai, H.D., et al., Mitochondria DNA deletion and copy numbers of cumulus cells associated with in vitro fertilization outcomes. The Journal of Reproductive Medicine. 2010. 55(11-12): p. 491-7.

 [263] Villa, A., et al., Decrease of ultraviolet A light-induced "common deletion" in healthy volunteers after oral Polypodium leucotomos extract supplement in a randomized clinical trial. Journal of the American Academy of Dermatology. 2010. 62(3): p. 511-3.

 [264] Ye, C., et al., Quantitative analysis of mitochondrial DNA 4977-bp deletion in sporadic breast cancer and benign breast diseases. Breast Cancer Res Treat. 2008. 108(3): p. 427-34.

 [265] Rocher, C., et al., Base composition at mtDNA boundaries suggests a DNA triple helix model for human mitochondrial DNA large-scale rearrangements. Molecular Genetics and Metabolism. 2002. 76(2): p. 123-32.

 [266] Hamblet, N.S. and F.J. Castora, Mitochondrial DNA deletion analysis: a comparison of PCR quantitative methods. Biochemical and Biophysical Research Communications. 1995. 207(2): p. 839-47.

 [267] Maassen, J.A. and T. Kadowaki, Maternally inherited diabetes and deafness: a new diabetes subtype. Diabetologia. 1996. 39(4): p. 375-82.

 [325] Krishnan, K. J. and Birch-Machin, M. A., The incidence of both tandem duplications and the common deletion in mtDNA from three distinct categories of sun-exposed human skin and in prolonged culture of fibroblasts.The Journal of Investigative Dermatology. 2006. 126(2): p. 408-415.

 [326] Hjelm, B.E., et al., .in preparation

 [329] Vielhaber, Stefan, et al., Mitofusin 2 mutations affect mitochondrial function by mitochondrial DNA depletion.Acta Neuropathologica. 2013. 125(2): p. 245-256

 [330] Volmering, E., et al., Neuropathological signs of inflammation correlate with mitochondrial DNA deletions in mesial temporal lobe epilepsy.Acta Neuropathologica. 2016. 132(2): p. 277-88