8476 - 14812 Homo sapiens - Duplications Duplication length: 10234 bp Duplicated region: 14812:8476 Partially duplicated molecule length: 26803 bp Duplicates OL and OH Duplicating part of minor and major arcs	Breakpoint flanking sequences more information in Documentation - Flanking regions
	8476 5fl vs 3del Homology length: 7 bp Non-duplicated region 14812 CAAACTACCACCTACCTCCC ├ 5'Breakpoint ┤ TCACCAAAGCCCATAAAAAT (...) CACTCATTCATCGACCTCCC ├ 3'Breakpoint ┤ CACCCCATCCAACATCTCCG 5fl vs 3fl Homology length: 1 bp CAAACTACCACCTACCTCCC ├ 5'Breakpoint ┤ TCACCAAAGCCCATAAAAAT (...) CACTCATTCATCGACCTCCC ├ 3'Breakpoint ┤ CACCCCATCCAACATCTCCG

Two-dimensional scatterplot showing the location of the selected duplication (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.	Circular mtDNA plot specifying the location of the duplicated region (black bar).
Length distribution of the duplicated region in the selected duplication (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

References

 [25] Ferlin, T., et al., Detection of mitochondrial DNA deletions by a screening procedure using the polymerase chain reaction. Molecular and Cellular Biochemistry. 1997. 174: p. 221-225.