Loading, please wait...

Loading, please wait.



8424 - 11503
Homo sapiens - Deletions

Deletion length: 3078 bp

Does not remove any origin of replication
Inside the major arc



Breakpoint flanking sequences
more information in Documentation - Flanking regions
8424 Deleted region 11503
ACCCCCATACTCCTTACACT 5'Breakpoint ATTCCTCATCACCCAACTAA (...) GGTATAATACGCCTCACACT 3'Breakpoint CATTCTCAACCCCCTGACAA




Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.

Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

References

 [304] Wong, L-J. C., et al., Compensatory amplification of mtDNA in a patient with a novel deletion/duplication and high mutant load. Journal of Medical Genetics. 2003. 40(11): p. e215.