8034 - 16076 Homo sapiens - Deletions Deletion length: 8041 bp Does not remove any origin of replication Inside the major arc	Breakpoint flanking sequences more information in Documentation - Flanking regions
	8034 5fl vs 3del Homology length: 5 bp Deleted region 16076 CTCCCGATTGAAGCCCCCAT ├ 5'Breakpoint ┤ TCGTATAATAATTACATCAC (...) CCAAGTATTGACTCACCCAT ├ 3'Breakpoint ┤ CAACAACCGCTATGTATTTC 5del vs 3del Homology length: 1 bp CTCCCGATTGAAGCCCCCAT ├ 5'Breakpoint ┤ TCGTATAATAATTACATCAC (...) CCAAGTATTGACTCACCCAT ├ 3'Breakpoint ┤ CAACAACCGCTATGTATTTC

Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.	Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

Present in:
ad/ar-PEO; Mitochondrial myopathy
Sublimons; Aged tissues
Inclusion body myositis
Chronic Uremia; Ptosis; Proximal limb weakness; Hippocampal tissue of patients with mesial temporal lobe epilepsy (mTLE) and hippocampal sclerosis (HS)

References

 [15] Regan, C., Sequence characterization of breakpoint regions of human mitochondrial DNA deletions and possible mechanisms of formation. PhD Thesis. 1999.

 [23] Kajander, O.A., et al., Human mtDNA sublimons resemble rearranged mitochondrial genoms found in pathological states. Human Molecular Genetics. 2000. 9(19): p. 2821-35.

 [24] Moslemi, A.R., C. Lindberg, and A. Oldfors, Analysis of multiple mitochondrial DNA deletions in inclusion body myositis. Human Mutation. 1997. 10(5): p. 381-6.

 [25] Samuels, D.C., E.A. Schon, and P.F. Chinnery, Two direct repeats cause most human mtDNA deletions. Trends in Genetics. 2004. 20(9): p. 393-8.

 [38] Lim, P.S., et al., Mitochondrial DNA mutations and oxidative damage in skeletal muscle of patients with chronic uremia. Journal of Biomedical Science. 2002. 9(6 Pt 1): p. 549-60.

 [163] Zhang, C., et al., Multiple Mitochondrial-DNA Deletions in an Elderly Human Individual. FEBS Letters. 1992. 297(1-2): p. 34-38.

 [167] Zeviani, M., et al., An Autosomal Dominant Disorder with Multiple Deletions of Mitochondrial-DNA Starting at the D-Loop Region. Nature. 1989. 339(6222): p. 309-311.

 [176] Moslemi, A.R., et al., Clonal expansion of mitochondrial DNA with multiple deletions in autosomal dominant progressive external ophthalmoplegia. Annals of Neurology. 1996. 40(5): p. 707-713.

 [330] Volmering, E., et al., Neuropathological signs of inflammation correlate with mitochondrial DNA deletions in mesial temporal lobe epilepsy. Acta Neuropathologica. 2016. 132(2): p. 277-288.