8032 - 16073 Homo sapiens - Deletions Deletion length: 8040 bp Does not remove any origin of replication Inside the major arc	Breakpoint flanking sequences more information in Documentation - Flanking regions
	8032 5fl vs 3del Homology length: 2 bp Deleted region 16073 TACTCCCGATTGAAGCCCCC ├ 5'Breakpoint ┤ ATTCGTATAATAATTACATC (...) CACCCAAGTATTGACTCACC ├ 3'Breakpoint ┤ CATCAACAACCGCTATGTAT 5fl vs 3fl Homology length: 1 bp TACTCCCGATTGAAGCCCCC ├ 5'Breakpoint ┤ ATTCGTATAATAATTACATC (...) CACCCAAGTATTGACTCACC ├ 3'Breakpoint ┤ CATCAACAACCGCTATGTAT

Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.	Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

Present in:
ad-PEO; Mitochondrial myopathy
Aged tissues
Inclusion body myositis

References

 [24] Moslemi, A.R., C. Lindberg, and A. Oldfors, Analysis of multiple mitochondrial DNA deletions in inclusion body myositis. Human Mutation. 1997. 10(5): p. 381-6.

 [167] Zeviani, M., et al., An Autosomal Dominant Disorder with Multiple Deletions of Mitochondrial-DNA Starting at the D-Loop Region. Nature. 1989. 339(6222): p. 309-311.

 [176] Moslemi, A.R., et al., Clonal expansion of mitochondrial DNA with multiple deletions in autosomal dominant progressive external ophthalmoplegia. Annals of Neurology. 1996. 40(5): p. 707-713.

 [283] Baumer, A., et al., Age-Related Human Mtdna Deletions - a Heterogeneous Set of Deletions Arising at a Single Pair of Directly Repeated Sequences. American Journal of Human Genetics. 1994. 54(4): p. 618-630.