Loading, please wait...

Loading, please wait.



8030 - 16070
Homo sapiens - Deletions

Deletion length: 8039 bp

Does not remove any origin of replication
Inside the major arc



Breakpoint flanking sequences
more information in Documentation - Flanking regions
8030 Deleted region 16070
AGTACTCCCGATTGAAGCCC 5'Breakpoint CCATTCGTATAATAATTACA (...) TACCACCCAAGTATTGACTC 3'Breakpoint ACCCATCAACAACCGCTATG




Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.

Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.
Present in:
Mitochondrial myopathy
Skeletal muscle biopsies and fibroblasts of Charcot-Marie-Tooth hereditary neuropathy type 2A patients

References

 [167] Zeviani, M., et al., An Autosomal Dominant Disorder with Multiple Deletions of Mitochondrial-DNA Starting at the D-Loop Region. Nature. 1989. 339(6222): p. 309-311.

 [329] Vielhaber, Stefan, et al., Mitofusin 2 mutations affect mitochondrial function by mitochondrial DNA depletion. Acta Neuropathologica. 2013. 125(2): p. 245-256.