7982 - 15504 Homo sapiens - Deletions Deletion length: 7521 bp Does not remove any origin of replication Inside the major arc	Breakpoint flanking sequences more information in Documentation - Flanking regions
	7982 5fl vs 3del Homology length: 8 bp Deleted region 15504 ATTCCTAGAACCAGGCGACC ├ 5'Breakpoint ┤ TGCGACTCCTTGACGTTGAC (...) ACCAGACCTCCTAGGCGACC ├ 3'Breakpoint ┤ CAGACAATTATACCCTAGCC 5fl vs 3fl Homology length: 1 bp ATTCCTAGAACCAGGCGACC ├ 5'Breakpoint ┤ TGCGACTCCTTGACGTTGAC (...) ACCAGACCTCCTAGGCGACC ├ 3'Breakpoint ┤ CAGACAATTATACCCTAGCC

Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.	Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

Present in:
KSS; PEO
Mitochondrial myopathy
MELAS; Ptosis; Proximal limb weakness; Chronic fatigue syndrome; Ataxia; Seizures; other neurological symptoms; Hippocampal tissue of patients with mesial temporal lobe epilepsy (mTLE) and hippocampal sclerosis (HS)

References

 [15] Regan, C., Sequence characterization of breakpoint regions of human mitochondrial DNA deletions and possible mechanisms of formation. PhD Thesis. 1999.

 [40] Mita, S., et al., Recombination Via Flanking Direct Repeats Is a Major Cause of Large-Scale Deletions of Human Mitochondrial-DNA. Nucleic Acids Research. 1990. 18(3): p. 561-567.

 [42] Nakase, H., et al., Transcription and Translation of Deleted Mitochondrial Genomes in Kearns-Sayre Syndrome - Implications for Pathogenesis. American Journal of Human Genetics. 1990. 46(3): p. 418-427.

 [43] Zupanc, M.L., et al., Deletion of mitochondrial DNA in patients with combined features of Kearns-Sayre and MELAS syndromes. Annals of Neurology. 1991. 29(6): p. 680-3.

 [265] Rocher, C., et al., Base composition at mtDNA boundaries suggests a DNA triple helix model for human mitochondrial DNA large-scale rearrangements. Molecular Genetics and Metabolism. 2002. 76(2): p. 123-32.

 [326] Hjelm, B.E., et al., . in preparation

 [330] Volmering, E., et al., Neuropathological signs of inflammation correlate with mitochondrial DNA deletions in mesial temporal lobe epilepsy. Acta Neuropathologica. 2016. 132(2): p. 277-288.