Loading, please wait...

Loading, please wait.



7835 - 14331
Homo sapiens - Duplications

Duplication length: 10074 bp
Duplicated region: 14331:7835

Partially duplicated molecule length: 26643 bp

Duplicates OL and OH
Duplicating part of minor and major arcs



Breakpoint flanking sequences
more information in Documentation - Flanking regions
7835 Non-duplicated region 14331
CCTCCCATCCCTACGCATCC 5'Breakpoint TTTACATAACAGACGAGGTC (...) TACACTATTAAAGTTTACCA 3'Breakpoint CAACCACCACCCCATCATAC




Two-dimensional scatterplot showing the location of the selected duplication (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.

Circular mtDNA plot specifying the location of the duplicated region (black bar).
Length distribution of the duplicated region in the selected duplication (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.
Present in:
KSS
Leigh disease

References

 [5] Fromenty, B., et al., High proportions of mtDNA duplications in patients with Kearns-Sayre syndrome occur in the heart. American Journal of Medical Genetics. 1997. 71: p. 443-452

 [28] Fromenty, B., et al., Efficient and specific amplification of identified partial duplications of human mitochondrial DNA by long PCR. Biochimica et Biophysica Acta. 1993. 1308: p. 222-230.