7824 - 16077 Homo sapiens - Deletions Deletion length: 8252 bp Does not remove any origin of replication Inside the major arc	Breakpoint flanking sequences more information in Documentation - Flanking regions
	7824 5fl vs 3del Homology length: 6 bp Deleted region 16077 GTCCTCATCGCCCTCCCATC ├ 5'Breakpoint ┤ CCTACGCATCCTTTACATAA (...) CAAGTATTGACTCACCCATC ├ 3'Breakpoint ┤ AACAACCGCTATGTATTTCG 5del vs 3del Homology length: 1 bp GTCCTCATCGCCCTCCCATC ├ 5'Breakpoint ┤ CCTACGCATCCTTTACATAA (...) CAAGTATTGACTCACCCATC ├ 3'Breakpoint ┤ AACAACCGCTATGTATTTCG

Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.	Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

Present in:
ad/ar-PEO; ad/ar-PEO (POLGmut); Mitochondrial myopathy; Patients with pathogenic POLG mutations
Sublimons

References

 [23] Kajander, O.A., et al., Human mtDNA sublimons resemble rearranged mitochondrial genoms found in pathological states. Human Molecular Genetics. 2000. 9(19): p. 2821-35.

 [167] Zeviani, M., et al., An Autosomal Dominant Disorder with Multiple Deletions of Mitochondrial-DNA Starting at the D-Loop Region. Nature. 1989. 339(6222): p. 309-311.

 [286] Wanrooij, S., et al., Twinkle and POLG defects enhance age-dependent accumulation of mutations in the control region of mtDNA. Nucleic Acids Research. 2004. 32(10): p. 3053-64.

 [327] Nicholls, Thomas J., et al., Linear mtDNA fragments and unusual mtDNA rearrangements associated with pathological deficiency of MGME1 exonuclease. Human Molecular Genetics. 2014. 23: p. 6147-6162.