Loading, please wait...

Loading, please wait.



7758 - 12455
Mus Musculus - Deletions

Deletion length: 4696 bp

Breakpoint flanking sequences
more information in Documentation - Flanking regions
7758 Deleted region 12455
TAGAGACCTTAAAATCTCCA 5'Breakpoint TAGTGATATGCCACAACTAG (...) TGACTACCATCAGCAATAGA 3'Breakpoint AGGCCCTACACCAGTTTCAG




Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.

Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

References

 [9] Inoue, K., et al., Generation of mice with mitochondrial dysfunction by introducing mouse mtDNA carrying a deletion into zygotes.Nature Genetics. 2000. 26(2): p. 176-81.

 [20] Ogasawara, E., et al., Lactic acidemia in the pathogenesis of mice carrying mitochondrial DNA with a deletion.Human Molecular Genetics. 2010. 19(16): p. 3179-89.