Loading, please wait...

Loading, please wait.



7697 - 12364
Homo sapiens - Deletions

Deletion length: 4666 bp

Does not remove any origin of replication
Inside the major arc



Breakpoint flanking sequences
more information in Documentation - Flanking regions
7697 Deleted region 12364
TTTCCTTATCTGCTTCCTAG 5'Breakpoint TCCTGTATGCCCTTTTCCTA (...) TGCACACTACTATAACCACC 3'Breakpoint CTAACCCTGACTTCCCTAAT




Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.

Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.
Present in:
KSS
Mitochondrial myopathy

References

 [34] Larsson, N.G., et al., Lack of Transmission of Deleted Mtdna from a Woman with Kearns-Sayre Syndrome to Her Child. American Journal of Human Genetics. 1992. 50(2): p. 360-363.

 [108] Oldfors, A., et al., Mitochondrial DNA deletions and cytochrome c oxidase deficiency in muscle fibres. Journal of the Neurological Sciences. 1992. 110(1-2): p. 169-77.