6329 - 13994 Homo sapiens - Deletions Deletion length: 7664 bp Does not remove any origin of replication Inside the major arc	Breakpoint flanking sequences more information in Documentation - Flanking regions
	6329 Deleted region 13994 ACTCCCACCCTGGAGCCTCC ├ 5'Breakpoint ┤ GTAGACCTAACCATCTTCTC (...) AAACCTGCCCCTACTCCTCC ├ 3'Breakpoint ┤ TAGACCTAACCTGACTAGAA

Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.	Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

Present in:
KSS; PS; PEO
Aged tissues
Reye-like; MELAS; LS; Skeletal muscle biopsies and fibroblasts of CMT2A patients; Hippocampal tissue of patients with mesial temporal lobe epilepsy (mTLE) and hippocampal sclerosis (HS)

References

 [9] Bua, E., et al., Mitochondrial DNA-deletion mutations accumulate intracellularly to detrimental levels in aged human skeletal muscle fibers. American Journal of Human Genetics. 2006. 79(3): p. 469-80.

 [26] Solano, A., et al., Characterisation of repeat and palindrome elements in patients harbouring single deletions of mitochondrial DNA. Journal of Medical Genetics. 2003. 40(7): p. e86.

 [32] Kraytsberg, Y., et al., Mitochondrial DNA deletions are abundant and cause functional impairment in aged human substantia nigra neurons. Nature Genetics. 2006. 38(5): p. 518-20.

 [45] Yamashita, S., et al., Genotype and phenotype analyses in 136 patients with single large-scale mitochondrial DNA deletions. Journal of Human Genetics. 2008. 53(7): p. 598-606.

 [119] Johns, D.R., et al., Directly repeated sequences associated with pathogenic mitochondrial DNA deletions. Proceedings of the National Academy of Sciences of the United States of America. 1989. 86(20): p. 8059-62.

 [265] Rocher, C., et al., Base composition at mtDNA boundaries suggests a DNA triple helix model for human mitochondrial DNA large-scale rearrangements. Molecular Genetics and Metabolism. 2002. 76(2): p. 123-32.

 [326] Hjelm, B.E., et al., . in preparation

 [329] Vielhaber, Stefan, et al., Mitofusin 2 mutations affect mitochondrial function by mitochondrial DNA depletion. Acta Neuropathologica. 2013. 125(2): p. 245-256.

 [330] Volmering, E., et al., Neuropathological signs of inflammation correlate with mitochondrial DNA deletions in mesial temporal lobe epilepsy. Acta Neuropathologica. 2016. 132(2): p. 277-288.

 [339] Zhu, Q., Chen, C., & Yao, J., Kearns–Sayre syndrome with a novel large-scale deletion: a case report..BMC ophthalmology. 2022. 22(1): p.35.