Loading, please wait...

Loading, please wait.



5940 - 14289
Homo sapiens - Duplications

Duplication length: 8221 bp
Duplicated region: 14289:5940

Partially duplicated molecule length: 24790 bp

Duplicates OL and OH
Duplicating part of minor and major arcs



Breakpoint flanking sequences
more information in Documentation - Flanking regions
5940 Non-duplicated region 14289
ACTATTCTCTACAAACCACA 5'Breakpoint AAGACATTGGAACACTATAC (...) AATCAACCCTGACCCCTCTC 3'Breakpoint CTTCATAAATTATTCAGCTT




Two-dimensional scatterplot showing the location of the selected duplication (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.

Circular mtDNA plot specifying the location of the duplicated region (black bar).
Length distribution of the duplicated region in the selected duplication (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.