Loading, please wait...

Loading, please wait.



5782 - 14302
Homo sapiens - Duplications

Duplication length: 8050 bp
Duplicated region: 14302:5782

Partially duplicated molecule length: 24619 bp

Duplicates OL and OH
Duplicating part of minor and major arcs



Breakpoint flanking sequences
more information in Documentation - Flanking regions
5782 Non-duplicated region 14302
GCCCCGGCAGGTTTGAAGCT 5'Breakpoint GCTTCTTCGAATTTGCAATT (...) CCCTCTCCTTCATAAATTAT 3'Breakpoint TCAGCTTCCTACACTATTAA




Two-dimensional scatterplot showing the location of the selected duplication (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.

Circular mtDNA plot specifying the location of the duplicated region (black bar).
Length distribution of the duplicated region in the selected duplication (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

References

 [16] Puoti, G., et al., Identical large scale rearrangement of mitochondrial DNA causes Kearns-Sayre syndrome in a mother and her son. Journal of Medical Genetics. 2003. 40: p. 585-863.