573 - 309 Homo sapiens - Duplications Duplication length: 265 bp Duplicated region: 309:573 Partially duplicated molecule length: 16834 bp Duplicates OH Duplicating part of minor and major arcs	Breakpoint flanking sequences more information in Documentation - Flanking regions
	573 5fl vs 3del Homology length: 7 bp Non-duplicated region 309 AAACCCCAAAGACACCCCCC ├ 5'Breakpoint ┤ ACAGTTTATGTAGCTTACCT (...) AAATTTCCACCAAACCCCCC ├ 3'Breakpoint ┤ CTCCCCCGCTTCTGGCCACA 5fl vs 3fl Homology length: 1 bp AAACCCCAAAGACACCCCCC ├ 5'Breakpoint ┤ ACAGTTTATGTAGCTTACCT (...) AAATTTCCACCAAACCCCCC ├ 3'Breakpoint ┤ CTCCCCCGCTTCTGGCCACA

Two-dimensional scatterplot showing the location of the selected duplication (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.	Circular mtDNA plot specifying the location of the duplicated region (black bar).
Length distribution of the duplicated region in the selected duplication (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

Present in:
Mitochondrial myopathy
Control
Sun-exposed skin

References

 [6] Brockington, M., et al., A tandem duplication in the D-loop of human mitochondrial DNA is associated with deletions in mitochondrial myopathies. Nature Genetics. 1993. 4(1): p. 67-71.

 [10] Poltoun, J., et al., Restriction enzyme analysis of the mitochondrial genome in mitochondrial myopathy. Journal of Medical Genetics. 1988. 25(9): p. 600-605

 [11] Schurr, T. G., et al., Amerindian mitochondrial DNAs have rare Asian mutations at high frequencies, suggesting they derived from four primary maternal lineages. American Journal of Human Genetics. 1990. 46(3): p. 613-623.

 [30] Torroni, A., et al., mtDNA and the origin of caucasians: identification of ancient caucasian-specific haplogroups, one of which is prone to a recurrent somatic duplication in the D-Loop region.American Journal of Human Genetics. 1994. 55: p. 760-776.

 [31] Wei, Y-H., et al., Tandem duplications and large-scale deletions of mitochondrial DNA are early molecular events of human ageing process.Annals of New York Academy of Sciences. 1996. 786: p. 82-101.

 [32] Krishnan, K. J. and Birch-Machin, M. A., The incidence of both tandem duplications and the common deletion in mtDNA from three distinct categories of sun-exposed human skin and in prolonged culture of fibroblasts.The Journal of Investigative Dermatology. 2006. 126(2): p. 408-415.