563 - 360 Homo sapiens - Duplications Duplication length: 204 bp Duplicated region: 360:563 Partially duplicated molecule length: 16773 bp Duplicates OH Duplicating part of minor and major arcs	Breakpoint flanking sequences more information in Documentation - Flanking regions
	563 5fl vs 3del Homology length: 12 bp Non-duplicated region 360 CGAACCAACCAAACCCCAAA ├ 5'Breakpoint ┤ GACACCCCCCACAGTTTATG (...) CATCTCTGCCAAACCCCAAA ├ 3'Breakpoint ┤ AACAAAGAACCCTAACACCA 5fl vs 3fl Homology length: 2 bp CGAACCAACCAAACCCCAAA ├ 5'Breakpoint ┤ GACACCCCCCACAGTTTATG (...) CATCTCTGCCAAACCCCAAA ├ 3'Breakpoint ┤ AACAAAGAACCCTAACACCA

Two-dimensional scatterplot showing the location of the selected duplication (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.	Circular mtDNA plot specifying the location of the duplicated region (black bar).
Length distribution of the duplicated region in the selected duplication (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

References

 [2] Bouzidi, M. F., et al., Co-existence of high levels of a cytochrome b mutation and of a tandem 200 bp duplication in the D-loop of muscle human mitochondrial DNA. Human Molecular Genetics. 1998. 7(3): p. 385-391

 [31] Wei, Y-H., et al., Tandem duplications and large-scale deletions of mitochondrial DNA are early molecular events of human ageing process.Annals of New York Academy of Sciences. 1996. 786: p. 82-101.

 [32] Krishnan, K. J. and Birch-Machin, M. A., The incidence of both tandem duplications and the common deletion in mtDNA from three distinct categories of sun-exposed human skin and in prolonged culture of fibroblasts.The Journal of Investigative Dermatology. 2006. 126(2): p. 408-415.