547 - 4443 Homo sapiens - Deletions Deletion length: 3895 bp Does not remove any origin of replication Inside the minor arc	Breakpoint flanking sequences more information in Documentation - Flanking regions
	547 5fl vs 3del Homology length: 13 bp Deleted region 4443 TGCTAACCCCATACCCCGAA ├ 5'Breakpoint ┤ CCAACCAAACCCCAAAGACA (...) TATCGGGCCCATACCCCGAA ├ 3'Breakpoint ┤ AATGTTGGTTATACCCTTCC 5fl vs 3fl Homology length: 2 bp TGCTAACCCCATACCCCGAA ├ 5'Breakpoint ┤ CCAACCAAACCCCAAAGACA (...) TATCGGGCCCATACCCCGAA ├ 3'Breakpoint ┤ AATGTTGGTTATACCCTTCC

Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.	Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

Present in:
KSS; PEO
ad/ar-PEO
Aged tissues; Skin (epithelial swab); Controls
Non-melanoma skin cancer
PEO-like HIV patients; Chronic fatigue syndrome; Isolated mitochondrial myopathy; Skeletal muscle biopsies and fibroblasts of CMT2A patients

References

 [14] Eshaghian, A., et al., Mitochondrial DNA deletions serve as biomarkers of aging in the skin, but are typically absent in nonmelanoma skin cancers. Journal of Investigative Dermatology. 2006. 126(2): p. 336-44.

 [41] Moraes, C.T., et al., Molecular analysis of the muscle pathology associated with mitochondrial DNA deletions. Nature Genetics. 1992. 1(5): p. 359-67.

 [138] Moraes, C.T., et al., Phenotype-genotype correlations in skeletal muscle of patients with mtDNA deletions. Muscle & Nerve. 1995. 3: p. S150-3.

 [168] Carrozzo, R., et al., Multiple mtDNA deletions features in autosomal dominant and recessive diseases suggest distinct pathogeneses. Neurology. 1998. 50(1): p. 99-106.

 [169] Harbottle, A., K.J. Krishnan, and M.A. Birch-Machin, Implications of using the ND1 gene as a control region for real-time PCR analysis of mitochondrial DNA deletions in human skin. Journal of Investigative Dermatology. 2004. 122(6): p. 1518-21.

 [170] Harbottle, A., et al., Real-time polymerase chain reaction analysis of a 3895-bp mitochondrial DNA deletion in epithelial swabs and its use as a quantitative marker for sunlight exposure in human skin. British Journal of Dermatology. 2010. 163(6): p. 1291-5.

 [171] Krishnan, K.J., A. Harbottle, and M.A. Birch-Machin, The use of a 3895 bp mitochondrial DNA deletion as a marker for sunlight exposure in human skin. Journal of Investigative Dermatology. 2004. 123(6): p. 1020-4.

 [172] Moraes, C.T., et al., Replication-competent human mitochondrial DNA lacking the heavy-strand promoter region. Molecular and Cellular Biology. 1991. 11(3): p. 1631-7.

 [173] Pfeffer, G., et al., Ophthalmoplegia and ptosis: mitochondrial toxicity in patients receiving HIV therapy. Neurology. 2009. 73(1): p. 71-2.

 [174] Vu, T.H., et al., Analysis of mtDNA deletions in muscle by in situ hybridization. Muscle & Nerve. 2000. 23(1): p. 80-5.

 [265] Rocher, C., et al., Base composition at mtDNA boundaries suggests a DNA triple helix model for human mitochondrial DNA large-scale rearrangements. Molecular Genetics and Metabolism. 2002. 76(2): p. 123-32.

 [329] Vielhaber, Stefan, et al., Mitofusin 2 mutations affect mitochondrial function by mitochondrial DNA depletion. Acta Neuropathologica. 2013. 125(2): p. 245-256.