493 - 301 Homo sapiens - Duplications Duplication length: 193 bp Duplicated region: 301:493 Partially duplicated molecule length: 16762 bp Duplicates OH Duplicating part of minor and major arcs	Breakpoint flanking sequences more information in Documentation - Flanking regions
	493 5fl vs 3del Homology length: 1 bp Non-duplicated region 301 TACTAATCTCATCAATACAA ├ 5'Breakpoint ┤ CCCCCGCCCATCCTACCCAG (...) ATAACAAAAAATTTCCACCA ├ 3'Breakpoint ┤ AACCCCCCCTCCCCCGCTTC 5fl vs 3fl Homology length: 2 bp TACTAATCTCATCAATACAA ├ 5'Breakpoint ┤ CCCCCGCCCATCCTACCCAG (...) ATAACAAAAAATTTCCACCA ├ 3'Breakpoint ┤ AACCCCCCCTCCCCCGCTTC

Two-dimensional scatterplot showing the location of the selected duplication (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.	Circular mtDNA plot specifying the location of the duplicated region (black bar).
Length distribution of the duplicated region in the selected duplication (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

Present in:
Mitochondrial myopathy
Aged tissues; control

References

 [10] Poltoun, J., et al., Restriction enzyme analysis of the mitochondrial genome in mitochondrial myopathy. Journal of Medical Genetics. 1988. 25(9): p. 600-605

 [11] Schurr, T. G., et al., Amerindian mitochondrial DNAs have rare Asian mutations at high frequencies, suggesting they derived from four primary maternal lineages. American Journal of Human Genetics. 1990. 46(3): p. 613-623.

 [18] Wei, Y-H., et al., Oxidative stress, mitochondrial DNA mutation, and impairment of antioxidant enzymes in aging. Experimental Biology and Medicine. 2002. 227: p. 671-682.