Loading, please wait...

Loading, please wait.



459 - 16184
Homo sapiens - Duplications

Duplication length: 845 bp
Duplicated region: 16184:459

Partially duplicated molecule length: 17414 bp

Duplicates OH
Duplicating part of minor and major arcs



Breakpoint flanking sequences
more information in Documentation - Flanking regions
459 Non-duplicated region 16184
ACTAACACATTATTTTCCCC 5'Breakpoint TCCCACTCCCATACTACTAA (...) AAACCCAATCCACATCAAAA 3'Breakpoint CCCCCTCCCCATGCTTACAA




Two-dimensional scatterplot showing the location of the selected duplication (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.

Circular mtDNA plot specifying the location of the duplicated region (black bar).
Length distribution of the duplicated region in the selected duplication (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

References

 [31] Wei, Y-H., et al., Tandem duplications and large-scale deletions of mitochondrial DNA are early molecular events of human ageing process.Annals of New York Academy of Sciences. 1996. 786: p. 82-101.