3614 - 12987 Homo sapiens - Deletions Deletion length: 9372 bp Removes OL Removing part of minor and major arcs	Breakpoint flanking sequences more information in Documentation - Flanking regions
	3614 5fl vs 3del Homology length: 11 bp Deleted region 12987 AACCTCAACCTAGGCCTCCT ├ 5'Breakpoint ┤ ATTTATTCTAGCCACCTCTA (...) ACCCCACTACTAGGCCTCCT ├ 3'Breakpoint ┤ CCTAGCAGCAGCAGGCAAAT 5fl vs 3fl Homology length: 3 bp AACCTCAACCTAGGCCTCCT ├ 5'Breakpoint ┤ ATTTATTCTAGCCACCTCTA (...) ACCCCACTACTAGGCCTCCT ├ 3'Breakpoint ┤ CCTAGCAGCAGCAGGCAAAT

Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.	Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

Present in:
Patients with pathogenic MGME1 mutations
Aged tissues
Hippocampal tissue of patients with mesial temporal lobe epilepsy (mTLE) and hippocampal sclerosis (HS)

References

 [6] Bodyak, N.D., et al., Quantification and sequencing of somatic deleted mtDNA in single cells: evidence for partially duplicated mtDNA in aged human tissues. Human Molecular Genetics. 2001. 10(1): p. 17-24.

 [327] Nicholls, Thomas J., et al., Linear mtDNA fragments and unusual mtDNA rearrangements associated with pathological deficiency of MGME1 exonuclease. Human Molecular Genetics. 2014. 23: p. 6147-6162.

 [330] Volmering, E., et al., Neuropathological signs of inflammation correlate with mitochondrial DNA deletions in mesial temporal lobe epilepsy. Acta Neuropathologica. 2016. 132(2): p. 277-288.