3577 - 15547 Homo sapiens - Duplications Duplication length: 4600 bp Duplicated region: 15547:3577 Partially duplicated molecule length: 21169 bp Duplicates OH Duplicating part of minor and major arcs	Breakpoint flanking sequences more information in Documentation - Flanking regions
	3577 5fl vs 3del Homology length: 10 bp Non-duplicated region 15547 ACTATGAACCCCCCTCCCCA ├ 5'Breakpoint ┤ TACCCAACCCCCTGGTCAAC (...) CCCTTAAACACCCCTCCCCA ├ 3'Breakpoint ┤ CATCAAGCCCGAATGATATT 5fl vs 3fl Homology length: 2 bp ACTATGAACCCCCCTCCCCA ├ 5'Breakpoint ┤ TACCCAACCCCCTGGTCAAC (...) CCCTTAAACACCCCTCCCCA ├ 3'Breakpoint ┤ CATCAAGCCCGAATGATATT

Two-dimensional scatterplot showing the location of the selected duplication (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.	Circular mtDNA plot specifying the location of the duplicated region (black bar).
Length distribution of the duplicated region in the selected duplication (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

References

 [7] Manfredi, G., et al., Association of myopathy with large-scale mitochondrial DNA duplications and deletions: which is pathogenic?. Annals of Neurology. 1997. 42(2): p. 180-188.

 [28] Fromenty, B., et al., Efficient and specific amplification of identified partial duplications of human mitochondrial DNA by long PCR. Biochimica et Biophysica Acta. 1993. 1308: p. 222-230.