Loading, please wait...

Loading, please wait.



3326 - 3591
Homo sapiens - Deletions

Deletion length: 264 bp

Does not remove any origin of replication
Inside the minor arc



Breakpoint flanking sequences
more information in Documentation - Flanking regions
3326 Deleted region 3591
ATACCCATGGCCAACCTCCT 5'Breakpoint ACTCCTCATTGTACCCATTC (...) CTCCCCATACCCAACCCCCT 3'Breakpoint GGTCAACCTCAACCTAGGCC




Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.

Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

References

 [156] Horton, T.M., et al., Novel mitochondrial DNA deletion found in a renal cell carcinoma. Genes Chromosomes & Cancer. 1996. 15(2): p. 95-101.

 [157] Penta, J.S., et al., Mitochondrial DNA in human malignancy. Mutation Research. 2001. 488(2): p. 119-33.