3325 - 13452 Homo sapiens - Duplications Duplication length: 6443 bp Duplicated region: 13452:3325 Partially duplicated molecule length: 23012 bp Duplicates OH Duplicating part of minor and major arcs	Breakpoint flanking sequences more information in Documentation - Flanking regions
	3325 5fl vs 3del Homology length: 1 bp Non-duplicated region 13452 CATACCCATGGCCAACCTCC ├ 5'Breakpoint ┤ TACTCCTCATTGTACCCATT (...) ATACCTCTCACTTCAACCTC ├ 3'Breakpoint ┤ CCTCACCATTGGCAGCCTAG 5fl vs 3fl Homology length: 2 bp CATACCCATGGCCAACCTCC ├ 5'Breakpoint ┤ TACTCCTCATTGTACCCATT (...) ATACCTCTCACTTCAACCTC ├ 3'Breakpoint ┤ CCTCACCATTGGCAGCCTAG

Two-dimensional scatterplot showing the location of the selected duplication (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.	Circular mtDNA plot specifying the location of the duplicated region (black bar).
Length distribution of the duplicated region in the selected duplication (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

References

 [13] Dunbar, D. R., Maternally transmitted partial direct tandem duplication of mitochondrial DNA associated with diabetes mellitus. Human Molecular Genetics. 1993. 2(10): p. 1619-1624.