306 - 357 Homo sapiens - Deletions Deletion length: 50 bp Does not remove any origin of replication Inside the major arc	Breakpoint flanking sequences more information in Documentation - Flanking regions
	306 5fl vs 3del Homology length: 9 bp Deleted region 357 AAAAATTTCCACCAAACCCC ├ 5'Breakpoint ┤ CCCTCCCCCGCTTCTGGCCA (...) ACACATCTCTGCCAAACCCC ├ 3'Breakpoint ┤ AAAAACAAAGAACCCTAACA 5del vs 3del Homology length: 3 bp AAAAATTTCCACCAAACCCC ├ 5'Breakpoint ┤ CCCTCCCCCGCTTCTGGCCA (...) ACACATCTCTGCCAAACCCC ├ 3'Breakpoint ┤ AAAAACAAAGAACCCTAACA

Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.	Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

Present in:
Controls
Hepatocellular carcinoma
Hypertension; Type 2 diabetes; Oral squamous cell carcinoma-derived cell lines

References

 [5] Bi, R., et al., The Acquisition of an Inheritable 50-bp Deletion in the Human mtDNA Control Region Does Not Affect the mtDNA Copy Number in Peripheral Blood Cells. Human Mutation. 2010. 31(5): p. 538-543.

 [35] Lee, H.C., et al., Somatic mutations in the D-loop and decrease in the copy number of mitochondrial DNA in human hepatocellular carcinoma. Mutation Research. 2004. 547(1-2): p. 71-8.

 [308] Challen, C., et al., Mitochondrial DNA mutations in head and neck cancer are infrequent and lack prognostic utility. British Journal of Cancer. 2011. 104: p. 1319-1324.

 [311] Elango, S., et al., Analysis if mitochondrial genome revealed a rare 50 bp deletion and substitutions in a family with hypertension. Mitochondrion. 2011. 11: p. 878-885.