16005 - 4885 Rattus norvegicus - Deletions Deletion length: 5193 bp	Breakpoint flanking sequences more information in Documentation - Flanking regions
	16005 5fl vs 3del Homology length: 9 bp Deleted region 4885 GTTAAGGGTCATTTATCCTC ├ 5'Breakpoint ┤ ATAGACAAAGCTCGAAAGAC (...) CAAAACATAATTTTATCCTC ├ 3'Breakpoint ┤ CCAACCCTCACAGTATTAAG 5fl vs 3fl Homology length: 1 bp GTTAAGGGTCATTTATCCTC ├ 5'Breakpoint ┤ ATAGACAAAGCTCGAAAGAC (...) CAAAACATAATTTTATCCTC ├ 3'Breakpoint ┤ CCAACCCTCACAGTATTAAG

Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.	Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

References

 [ 11 ] Gudikote, J. P., Van Tuyle, G. C., Rearrangements in the shorter arc of rat mitochondrial DNA involving the region of the heavy and light strand promoters.Mutation Research. 1996. 356(2): p. 275-86.