15497 - 15522 Homo sapiens - Deletions Deletion length: 24 bp Does not remove any origin of replication Inside the major arc	Breakpoint flanking sequences more information in Documentation - Flanking regions
	15497 5fl vs 3del Homology length: 5 bp Deleted region 15522 ATTCTCACCAGACCTCCTAG ├ 5'Breakpoint ┤ GCGACCCAGACAATTATACC (...) CCCAGACAATTATACCCTAG ├ 3'Breakpoint ┤ CCAACCCCTTAAACACCCCT 5del vs 3del Homology length: 1 bp ATTCTCACCAGACCTCCTAG ├ 5'Breakpoint ┤ GCGACCCAGACAATTATACC (...) CCCAGACAATTATACCCTAG ├ 3'Breakpoint ┤ CCAACCCCTTAAACACCCCT

Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.	Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

References

 [272] Andreu, A.L., et al., Exercise intolerance due to a nonsense mutation in the mtDNA ND4 gene. Annals of Neurology. 1999. 45(6): p. 820-823.

 [287] Andreu, A.L., et al., A missense mutation in the mitochondrial cytochrome b gene in a revisited case with histiocytoid cardiomyopathy. Pediatric Research. 2000. 48(3): p. 311-4.

 [288] Tanaka, M., et al., Mitochondrial genome single nucleotide polymorphisms and their phenotypes in the Japanese. Annals of the New York Academy of Sciences. 2004. 1011: p. 7-20.