1113 - 4934 Mus Musculus - Deletions Deletion length: 3820 bp	Breakpoint flanking sequences more information in Documentation - Flanking regions
	1113 5fl vs 3del Homology length: 2 bp Deleted region 4934 ACTAATCCTAGCCCTAGCCC ├ 5'Breakpoint ┤ TACACAAATATAATTATACT (...) CAATAACCCTACCCCTAGCC ├ 3'Breakpoint ┤ CCCCAACTAATTACCTAGAA 5fl vs 3fl Homology length: 3 bp ACTAATCCTAGCCCTAGCCC ├ 5'Breakpoint ┤ TACACAAATATAATTATACT (...) CAATAACCCTACCCCTAGCC ├ 3'Breakpoint ┤ CCCCAACTAATTACCTAGAA

Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.	Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

References

 [3] Eimon, P. M., et al., Age-associated mitochondrial DNA deletions on mouse skeletal muscle: comparison of different regions of the mitochondrial genome.Developmental Genetics. 1996. 18(2): p. 107-13.

 [4] Chung, S. S., et al., Analysis of age-associated mitochondrial DNA deletion breakpoint regions from mice suggests a novel model of deletion formation.Age. 1996. 19(4): p. 117-128.