Loading, please wait...

Loading, please wait.



11036 - 15439
Homo sapiens - Duplications

Duplication length: 12167 bp
Duplicated region: 15439:11036

Partially duplicated molecule length: 28736 bp

Duplicates OL and OH
Duplicating part of minor and major arcs



Breakpoint flanking sequences
more information in Documentation - Flanking regions
11036 Non-duplicated region 15439
TGAACCACTATCACGAAAAA 5'Breakpoint AACTCTACCTCTCTATACTA (...) ACAATCAAAGACGCCCTCGG 3'Breakpoint CTTACTTCTCTTCCTTCTCT




Two-dimensional scatterplot showing the location of the selected duplication (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.

Circular mtDNA plot specifying the location of the duplicated region (black bar).
Length distribution of the duplicated region in the selected duplication (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

References

 [27] Odoardi, F., et al., Pathogenic role of mtDNA duplications in mitochondrial diseases associated with mtDNA deletions. American Journal of Medical Genetics. 2003. 118A: p. 247-254.