9515 - 13055 Homo sapiens - Deletions Deletion length: 3539 bp Does not remove any origin of replication Inside the major arc	Breakpoint flanking sequences more information in Documentation - Flanking regions
	9515 5fl vs 3del Homology length: 1 bp Deleted region 13055 TTTTCTGAGCCTTTTACCAC ├ 5'Breakpoint ┤ TCCAGCCTAGCCCCTACCCC (...) CCCCTCAGCCATAGAAGGCC ├ 3'Breakpoint ┤ CCACCCCAGTCTCAGCCCTA 5fl vs 3fl Homology length: 4 bp TTTTCTGAGCCTTTTACCAC ├ 5'Breakpoint ┤ TCCAGCCTAGCCCCTACCCC (...) CCCCTCAGCCATAGAAGGCC ├ 3'Breakpoint ┤ CCACCCCAGTCTCAGCCCTA

Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.	Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

References

 [112] Reynier, P., et al., Association of deletion and homoplasmic point mutation of the mitochondrial DNA in an ocular myopathy. Biochemical and Biophysical Research Communications. 1994. 202(3): p. 1606-11.