Loading, please wait...

Loading, please wait.



8562 - 13759
Homo sapiens - Deletions

Deletion length: 5196 bp

Does not remove any origin of replication
Inside the major arc



Breakpoint flanking sequences
more information in Documentation - Flanking regions
8562 Deleted region 13759
TCGCTTCATTCATTGCCCCC 5'Breakpoint ACAATCCTAGGCCTACCCGC (...) TTACTAACAACATTTCCCCC 3'Breakpoint GCATCCCCCTTCCAAACAAC




Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.

Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.
Present in:
PEO
HeLa cells

References

 [150] Hayashi, J.I., et al., Introduction of Disease-Related Mitochondrial-DNA Deletions into Hela-Cells Lacking Mitochondrial-DNA Results in Mitochondrial Dysfunction. Proceedings of the National Academy of Sciences of the United States of America. 1991. 88(23): p. 10614-10618.

 [151] Hayashi, J., et al., Human mitochondria and mitochondrial genome function as a single dynamic cellular unit. The Journal of Cell Biology. 1994. 125(1): p. 43-50.