8058 - 12215 Homo sapiens - Deletions Deletion length: 4156 bp Does not remove any origin of replication Inside the major arc	Breakpoint flanking sequences more information in Documentation - Flanking regions
	8058 5fl vs 3fl Homology length: 8 bp Deleted region 12215 ATAATAATTACATCACAAGA ├ 5'Breakpoint ┤ CGTCTTGCACTCATGAGCTG (...) CCCTTATTTACCGAGAAAGC ├ 3'Breakpoint ┤ TCACAAGAACTGCTAACTCA 5del vs 3del Homology length: 1 bp ATAATAATTACATCACAAGA ├ 5'Breakpoint ┤ CGTCTTGCACTCATGAGCTG (...) CCCTTATTTACCGAGAAAGC ├ 3'Breakpoint ┤ TCACAAGAACTGCTAACTCA

Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.	Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

References

 [159] Lebrecht, D., et al., Tissue-specific mtDNA lesions and radical-associated mitochondrial dysfunction in human hearts exposed to doxorubicin. The Journal of Pathology. 2005. 207(4): p. 436-44.