7609 - 15413 Rattus norvegicus - Deletions Deletion length: 7804 bp	Breakpoint flanking sequences more information in Documentation - Flanking regions
	7609 5fl vs 3fl Homology length: 1 bp Deleted region 15413 ATGCTCTGAAATTTGCGGCT ├ 5'Breakpoint ┤ CAAATCACAGCTTCATACCC (...) TATTCTATTTAAACTACTTC ├ 3'Breakpoint ┤ TTGTCAGTACATAAAATGAT 5del vs 3del Homology length: 1 bp ATGCTCTGAAATTTGCGGCT ├ 5'Breakpoint ┤ CAAATCACAGCTTCATACCC (...) TATTCTATTTAAACTACTTC ├ 3'Breakpoint ┤ TTGTCAGTACATAAAATGAT

Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.	Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

References

 [ 2 ] Van Tuyle, G. C., et al., Multiple, large deletions in rat mitochondrial DNA: evidence for a major hot spot.Mutation Research. 1996. 349(1): p. 95-107.