7491 - 11004 Homo sapiens - Deletions Deletion length: 3512 bp Does not remove any origin of replication Inside the major arc	Breakpoint flanking sequences more information in Documentation - Flanking regions
	7491 5fl vs 3del Homology length: 9 bp Deleted region 11004 AAAGCTGGTTTCAAGCCAAC ├ 5'Breakpoint ┤ CCCATGGCCTCCATGACTTT (...) CACAATCATGGCAAGCCAAC ├ 3'Breakpoint ┤ GCCACTTATCCAGTGAACCA 5del vs 3del Homology length: 1 bp AAAGCTGGTTTCAAGCCAAC ├ 5'Breakpoint ┤ CCCATGGCCTCCATGACTTT (...) CACAATCATGGCAAGCCAAC ├ 3'Breakpoint ┤ GCCACTTATCCAGTGAACCA

Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.	Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

Present in:
KSS; PEO
Complex I deficiency

References

 [11] Degoul, F., et al., Different Mechanisms Inferred from Sequences of Human Mitochondrial-DNA Deletions in Ocular Myopathies. Nucleic Acids Research. 1991. 19(3): p. 493-496.

 [154] Degoul, F., et al., Deletions of mitochondrial DNA in Kearns-Sayre syndrome and ocular myopathies: genetic, biochemical and morphological studies. Journal of the Neurological Sciences. 1991. 101(2): p. 168-77.

 [265] Rocher, C., et al., Base composition at mtDNA boundaries suggests a DNA triple helix model for human mitochondrial DNA large-scale rearrangements. Molecular Genetics and Metabolism. 2002. 76(2): p. 123-32.