7283 - 14163 Rattus norvegicus - Deletions Deletion length: 6880 bp	Breakpoint flanking sequences more information in Documentation - Flanking regions
	7283 5fl vs 3del Homology length: 3 bp Deleted region 14163 ATAGACGAGATTAATAACCC ├ 5'Breakpoint ┤ AGTTCTAACAGTAAAGACTA (...) ACATCCGAAAATCTCACCCC ├ 3'Breakpoint ┤ CTATTCAAAATCATCAACCA 5fl vs 3fl Homology length: 1 bp ATAGACGAGATTAATAACCC ├ 5'Breakpoint ┤ AGTTCTAACAGTAAAGACTA (...) ACATCCGAAAATCTCACCCC ├ 3'Breakpoint ┤ CTATTCAAAATCATCAACCA

Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.	Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

References

 [ 13 ] Cao, Z., et al., Mitochondrial DNA deletion mutations are concomitant with ragged red regions of individual, aged muscle fibers: analysis by laser-capture microdissection.Nucleic Acids Research. 2001 29(21): p. 4502-8.