6551 - 13852 Homo sapiens - Deletions Deletion length: 7300 bp Does not remove any origin of replication Inside the major arc	Breakpoint flanking sequences more information in Documentation - Flanking regions
	6551 5fl vs 3del Homology length: 8 bp Deleted region 13852 TAACAGACCGCAACCTCAAC ├ 5'Breakpoint ┤ ACCACCTTCTTCGACCCCGC (...) TAACAGCCCTAGACCTCAAC ├ 3'Breakpoint ┤ TACCTAACCAACAAACTTAA 5del vs 3del Homology length: 2 bp TAACAGACCGCAACCTCAAC ├ 5'Breakpoint ┤ ACCACCTTCTTCGACCCCGC (...) TAACAGCCCTAGACCTCAAC ├ 3'Breakpoint ┤ TACCTAACCAACAAACTTAA

Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.	Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

Present in:
Multiple deletion patient (POLG1mut)
Aged tissues
PEO, Parkinson; Hippocampal tissue of patients with mesial temporal lobe epilepsy (mTLE) and hippocampal sclerosis (HS)

References

 [33] Reeve, A.K., et al., Nature of mitochondrial DNA deletions in substantia nigra neurons. American Journal of Human Genetics. 2008. 82(1): p. 228-35.

 [306] Campbell, G. R., et al., Mitochondrial DNA deletions and depletion within paraspinal muscles. Neuropatology and Applied Neurobiology. 2013. 39(4): p. 377-89.

 [326] Hjelm, B.E., et al., . in preparation

 [327] Nicholls, Thomas J., et al., Linear mtDNA fragments and unusual mtDNA rearrangements associated with pathological deficiency of MGME1 exonuclease. Human Molecular Genetics. 2014. 23: p. 6147-6162.

 [330] Volmering, E., et al., Neuropathological signs of inflammation correlate with mitochondrial DNA deletions in mesial temporal lobe epilepsy. Acta Neuropathologica. 2016. 132(2): p. 277-288.