6332 - 14920 Homo sapiens - Duplications Duplication length: 7982 bp Duplicated region: 14920:6332 Partially duplicated molecule length: 24551 bp Duplicates OL and OH Duplicating part of minor and major arcs	Breakpoint flanking sequences more information in Documentation - Flanking regions
	6332 5fl vs 3del Homology length: 1 bp Non-duplicated region 14920 CCCACCCTGGAGCCTCCGTA ├ 5'Breakpoint ┤ GACCTAACCATCTTCTCCTT (...) GCCATGCACTACTCACCAGA ├ 3'Breakpoint ┤ CGCCTCAACCGCCTTTTCAT 5del vs 3del Homology length: 2 bp CCCACCCTGGAGCCTCCGTA ├ 5'Breakpoint ┤ GACCTAACCATCTTCTCCTT (...) GCCATGCACTACTCACCAGA ├ 3'Breakpoint ┤ CGCCTCAACCGCCTTTTCAT

Two-dimensional scatterplot showing the location of the selected duplication (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.	Circular mtDNA plot specifying the location of the duplicated region (black bar).
Length distribution of the duplicated region in the selected duplication (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

References

 [29] Wilichowski, E., et al., Hypoparathyroidism and deafness associated with pleioplasmic large scale rearrangements of the mitochondrial DNA: a clinical and molecular genetic study of four children with Kearns-Sayre Syndrome.Pediatric Research. 1997. 41: p. 193-200.