6000 - 14911 Homo sapiens - Duplications Duplication length: 7659 bp Duplicated region: 14911:6000 Partially duplicated molecule length: 24228 bp Duplicates OL and OH Duplicating part of minor and major arcs	Breakpoint flanking sequences more information in Documentation - Flanking regions
	6000 5fl vs 3fl Homology length: 3 bp Non-duplicated region 14911 TGGAGTCCTAGGCACAGCTC ├ 5'Breakpoint ┤ TAAGCCTCCTTATTCGAGCC (...) CTATTCCTAGCCATGCACTA ├ 3'Breakpoint ┤ CTCACCAGACGCCTCAACCG 5del vs 3del Homology length: 2 bp TGGAGTCCTAGGCACAGCTC ├ 5'Breakpoint ┤ TAAGCCTCCTTATTCGAGCC (...) CTATTCCTAGCCATGCACTA ├ 3'Breakpoint ┤ CTCACCAGACGCCTCAACCG

Two-dimensional scatterplot showing the location of the selected duplication (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.	Circular mtDNA plot specifying the location of the duplicated region (black bar).
Length distribution of the duplicated region in the selected duplication (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

References

 [4] Houshmand, M., et al., Different tissue distribution of a mitochondrial DNA duplication and the correpondimg deletion in a patient with a mild mitochondrial encephalomyopathy: deletion in muscle, duplication in blood. Neuromuscular Disorders. 2004. 14: p. 195-201.