Loading, please wait...

Loading, please wait.



12112 - 14422
Homo sapiens - Deletions

Deletion length: 2309 bp

Does not remove any origin of replication
Inside the major arc



Breakpoint flanking sequences
more information in Documentation - Flanking regions
12112 Deleted region 14422
TCCTCCTATCCCTCAACCCC 5'Breakpoint GACATCATTACCGGGTTTTC (...) CTCACCAAGACCTCAACCCC 3'Breakpoint TGACCCCCATGCCTCAGGAT




Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.

Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.
Present in:
KSS; PEO; PS
Reye-like; MELAS; LS; Multisystemic mitochondrial disorders

References

 [26] Solano, A., et al., Characterisation of repeat and palindrome elements in patients harbouring single deletions of mitochondrial DNA. Journal of Medical Genetics. 2003. 40(7): p. e86.

 [40] Mita, S., et al., Recombination Via Flanking Direct Repeats Is a Major Cause of Large-Scale Deletions of Human Mitochondrial-DNA. Nucleic Acids Research. 1990. 18(3): p. 561-567.

 [44] Tengan, C.H., et al., Frequency of duplications in the D-loop in patients with mitochondrial DNA deletions. Biochimica Et Biophysica Acta. 2002. 1588(1): p. 65-70.

 [45] Yamashita, S., et al., Genotype and phenotype analyses in 136 patients with single large-scale mitochondrial DNA deletions. Journal of Human Genetics. 2008. 53(7): p. 598-606.

 [46] Hammans, S.R., et al., Evidence for intramitochondrial complementation between deleted and normal mitochondrial DNA in some patients with mitochondrial myopathy. Journal of the Neurological Sciences. 1992. 107(1): p. 87-92.

 [47] Hammans, S.R., et al., A molecular genetic study of focal histochemical defects in mitochondrial encephalomyopathies. Brain. 1992. 115 ( Pt 2): p. 343-65.

 [48] Herzberg, N.H., et al., Kearns-Sayre syndrome with a phenocopy of choroideremia instead of pigmentary retinopathy. Neurology. 1993. 43(1): p. 218-21.

 [322] Sadikovic, B., et al., Sequence homology at the breakpoint and clinical phenotype of mitochondrial DNA deletion syndromes. Plos one. 2010. 5(12): p. e15687.