9497 - 13735 Homo sapiens - Deletions Deletion length: 4237 bp Does not remove any origin of replication Inside the major arc	Breakpoint flanking sequences more information in Documentation - Flanking regions
	9497 5fl vs 3del Homology length: 12 bp Deleted region 13735 TTTTTTTCTTCGCAGGATTT ├ 5'Breakpoint ┤ TTCTGAGCCTTTTACCACTC (...) GAAGCCTATTCGCAGGATTT ├ 3'Breakpoint ┤ CTCATTACTAACAACATTTC 5del vs 3del Homology length: 2 bp TTTTTTTCTTCGCAGGATTT ├ 5'Breakpoint ┤ TTCTGAGCCTTTTACCACTC (...) GAAGCCTATTCGCAGGATTT ├ 3'Breakpoint ┤ CTCATTACTAACAACATTTC

Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.	Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

Present in:
KSS; PEO; PS
Mitochondrial myopathy
Aged tissues; Unfertilized oocytes
Peripheral myopathy; Mitochondrial cytopathy; LS; Hippocampal tissue of patients with mesial temporal lobe epilepsy (mTLE) and hippocampal sclerosis (HS)

References

 [7] Yuzaki, M., et al., Multiple deletions in mitochondrial DNA at direct repeats of non-D-loop regions in cases of familial mitochondrial myopathy. Biochemical and Biophysical Research Communications. 1989. 164(3): p. 1352-7.

 [18] Ferlin, T., et al., Detection of mitochondrial DNA deletions by a screening procedure using the polymerase chain reaction. Molecular and Cellular Biochemistry. 1997. 174(1-2): p. 221-225.

 [21] Hsieh, R.H., et al., Multiple rearrangements of mitochondrial DNA in unfertilized human oocytes. Fertility and Sterility. 2002. 77(5): p. 1012-7.

 [26] Solano, A., et al., Characterisation of repeat and palindrome elements in patients harbouring single deletions of mitochondrial DNA. Journal of Medical Genetics. 2003. 40(7): p. e86.

 [32] Kraytsberg, Y., et al., Mitochondrial DNA deletions are abundant and cause functional impairment in aged human substantia nigra neurons. Nature Genetics. 2006. 38(5): p. 518-20.

 [280] Blok, R.B., et al., Mtdna Deletion in a Patient with Symptoms of Mitochondrial Cytopathy but without Ragged-Red Fibers. Biochemical and Molecular Medicine. 1995. 56(1): p. 26-30.

 [330] Volmering, E., et al., Neuropathological signs of inflammation correlate with mitochondrial DNA deletions in mesial temporal lobe epilepsy. Acta Neuropathologica. 2016. 132(2): p. 277-288.