9194 - 15323 Homo sapiens - Deletions Deletion length: 6128 bp Does not remove any origin of replication Inside the major arc	Breakpoint flanking sequences more information in Documentation - Flanking regions
	9194 5fl vs 3del Homology length: 1 bp Deleted region 15323 CTAGTAAGCCTCTACCTGCA ├ 5'Breakpoint ┤ CGACAACACATAATGACCCA (...) CCTTCATTATTGCAGCCCTA ├ 3'Breakpoint ┤ GCAACACTCCACCTCCTATT 5fl vs 3fl Homology length: 3 bp CTAGTAAGCCTCTACCTGCA ├ 5'Breakpoint ┤ CGACAACACATAATGACCCA (...) CCTTCATTATTGCAGCCCTA ├ 3'Breakpoint ┤ GCAACACTCCACCTCCTATT

Two-dimensional scatterplot showing the location of the selected deletion (red diamond) versus the full dataset (grey dots). Each point represents an mtDNA rearrangement with the 5’ breakpoint on the x-axis and the 3’ breakpoint on the y-axis.	Circular mtDNA plot specifying the location of the deleted region (black bar).
Length distribution of the deleted region in the selected deletion (red bar) versus the full dataset (grey bars) .The cases were grouped 100-nt windows.

Present in:
ad-PEO; Mitochondrial myopathy
Peripheral myopathy

References

 [7] Yuzaki, M., et al., Multiple deletions in mitochondrial DNA at direct repeats of non-D-loop regions in cases of familial mitochondrial myopathy. Biochemical and Biophysical Research Communications. 1989. 164(3): p. 1352-7.

 [284] Zeviani, M., Nucleus-Driven Mutations of Human Mitochondrial-DNA. Journal of Inherited Metabolic Disease. 1992. 15(4): p. 456-471.

 [285] Zeviani, M., et al., Nucleus-Driven Multiple Large-Scale Deletions of the Human Mitochondrial Genome - a New Autosomal Dominant Disease. American Journal of Human Genetics. 1990. 47(6): p. 904-914.